ID: 1058263907

View in Genome Browser
Species Human (GRCh38)
Location 9:102873728-102873750
Sequence GAGACTTTGCTGCTTCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058263907_1058263914 24 Left 1058263907 9:102873728-102873750 CCTGAGAGAAGCAGCAAAGTCTC No data
Right 1058263914 9:102873775-102873797 GGTATCTTAGAGGACAGCTAAGG No data
1058263907_1058263913 14 Left 1058263907 9:102873728-102873750 CCTGAGAGAAGCAGCAAAGTCTC No data
Right 1058263913 9:102873765-102873787 GGATTGAAAAGGTATCTTAGAGG No data
1058263907_1058263908 -7 Left 1058263907 9:102873728-102873750 CCTGAGAGAAGCAGCAAAGTCTC No data
Right 1058263908 9:102873744-102873766 AAGTCTCTGCAGCCTCCCTCAGG No data
1058263907_1058263909 3 Left 1058263907 9:102873728-102873750 CCTGAGAGAAGCAGCAAAGTCTC No data
Right 1058263909 9:102873754-102873776 AGCCTCCCTCAGGATTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058263907 Original CRISPR GAGACTTTGCTGCTTCTCTC AGG (reversed) Intergenic
No off target data available for this crispr