ID: 1058266746

View in Genome Browser
Species Human (GRCh38)
Location 9:102909086-102909108
Sequence CATTCACATGTGTTTGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058266745_1058266746 22 Left 1058266745 9:102909041-102909063 CCATCTCTTGACTATTGTGAACT No data
Right 1058266746 9:102909086-102909108 CATTCACATGTGTTTGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058266746 Original CRISPR CATTCACATGTGTTTGCTTG AGG Intergenic