ID: 1058271827

View in Genome Browser
Species Human (GRCh38)
Location 9:102982018-102982040
Sequence CTGGGTCCTCACTTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058271827_1058271832 -1 Left 1058271827 9:102982018-102982040 CCTTCCACCAAGTGAGGACCCAG No data
Right 1058271832 9:102982040-102982062 GTAATTAGTCATCATTTATGAGG No data
1058271827_1058271833 4 Left 1058271827 9:102982018-102982040 CCTTCCACCAAGTGAGGACCCAG No data
Right 1058271833 9:102982045-102982067 TAGTCATCATTTATGAGGAATGG No data
1058271827_1058271834 5 Left 1058271827 9:102982018-102982040 CCTTCCACCAAGTGAGGACCCAG No data
Right 1058271834 9:102982046-102982068 AGTCATCATTTATGAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058271827 Original CRISPR CTGGGTCCTCACTTGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr