ID: 1058271832

View in Genome Browser
Species Human (GRCh38)
Location 9:102982040-102982062
Sequence GTAATTAGTCATCATTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058271827_1058271832 -1 Left 1058271827 9:102982018-102982040 CCTTCCACCAAGTGAGGACCCAG No data
Right 1058271832 9:102982040-102982062 GTAATTAGTCATCATTTATGAGG No data
1058271825_1058271832 1 Left 1058271825 9:102982016-102982038 CCCCTTCCACCAAGTGAGGACCC No data
Right 1058271832 9:102982040-102982062 GTAATTAGTCATCATTTATGAGG No data
1058271828_1058271832 -5 Left 1058271828 9:102982022-102982044 CCACCAAGTGAGGACCCAGTAAT No data
Right 1058271832 9:102982040-102982062 GTAATTAGTCATCATTTATGAGG No data
1058271829_1058271832 -8 Left 1058271829 9:102982025-102982047 CCAAGTGAGGACCCAGTAATTAG No data
Right 1058271832 9:102982040-102982062 GTAATTAGTCATCATTTATGAGG No data
1058271826_1058271832 0 Left 1058271826 9:102982017-102982039 CCCTTCCACCAAGTGAGGACCCA No data
Right 1058271832 9:102982040-102982062 GTAATTAGTCATCATTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058271832 Original CRISPR GTAATTAGTCATCATTTATG AGG Intergenic
No off target data available for this crispr