ID: 1058273371

View in Genome Browser
Species Human (GRCh38)
Location 9:103005349-103005371
Sequence GATGAAAAGAAGGATGAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1877
Summary {0: 1, 1: 0, 2: 9, 3: 238, 4: 1629}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058273368_1058273371 3 Left 1058273368 9:103005323-103005345 CCATAGAATTACAAGCTGTAAAA 0: 1
1: 0
2: 1
3: 22
4: 303
Right 1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG 0: 1
1: 0
2: 9
3: 238
4: 1629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058273371 Original CRISPR GATGAAAAGAAGGATGAGGA TGG Exonic
900038781 1:439773-439795 GAACAAAAGAAGGAAGAAGAGGG + Intergenic
900060215 1:674752-674774 GAACAAAAGAAGGAAGAAGAGGG + Intergenic
900097281 1:945083-945105 GATGAAGAGGACGAGGAGGAGGG - Exonic
900247132 1:1641760-1641782 GAGGAAGAGGAGGAGGAGGAAGG - Exonic
900258356 1:1708892-1708914 GAGGAAGAGGAGGAGGAGGAAGG - Exonic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900522302 1:3111551-3111573 AAGGAAGAGAAGGAGGAGGAAGG + Intronic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900753745 1:4418633-4418655 GAGGGAAGGAAGGAGGAGGAGGG - Intergenic
900968791 1:5977846-5977868 GAAGAAAGGAAGGAAGGGGACGG + Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901214932 1:7550004-7550026 GAGGGAAGGAAGGAGGAGGAGGG + Intronic
901313187 1:8285559-8285581 CTTGAAAATAAGGATGAGGTTGG + Intergenic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901640153 1:10688993-10689015 GAGGAAAAGGAGGAAGAGGTGGG + Intronic
901751705 1:11413945-11413967 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
901842621 1:11963706-11963728 GATGAGGAGGAGGAGGAGGAAGG - Intronic
901859971 1:12068148-12068170 GATGTGAAGAAGGGTGATGAGGG - Intronic
901963569 1:12847451-12847473 GATGAAAAAGAGGCTGAGGAAGG - Exonic
901984329 1:13062141-13062163 GATGAAAAAGGGGCTGAGGAAGG + Exonic
901997481 1:13164629-13164651 GATGAAAAAGGGGCTGAGGAAGG - Exonic
902093538 1:13923669-13923691 GATGAGGAGGAGGATGAGGAGGG + Intergenic
902102964 1:14008690-14008712 GATGAAAATGTTGATGAGGATGG + Intergenic
902425596 1:16319098-16319120 GATGAAAGGAAGAATAAGAAGGG + Intronic
902609861 1:17590640-17590662 GATGGACAGAAGGACAAGGAGGG + Intronic
902653840 1:17854073-17854095 GGGGAAAAGAAAGAAGAGGAAGG - Intergenic
902767357 1:18626266-18626288 GGAGAAGAGGAGGATGAGGAGGG + Intergenic
902980885 1:20122105-20122127 GATGATGAGGAGGAGGAGGACGG - Intergenic
903029084 1:20449802-20449824 GATGGTAACAAGGATGTGGAGGG + Intergenic
903187372 1:21636397-21636419 GAAGAAAGGAAGGAAGAGAAGGG - Intronic
903501892 1:23805033-23805055 GATGAGAATGAGGATGGGGAAGG - Intronic
904123813 1:28222130-28222152 GATGAAAAGAGTTATGAGGATGG + Intronic
904239209 1:29133207-29133229 GAAGAAAAGAAAGAAAAGGAAGG + Intergenic
904295199 1:29515757-29515779 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
904323290 1:29710538-29710560 GAAGAAAAGAAGGAACACGATGG + Intergenic
904434977 1:30488950-30488972 GATGATGAGGAGGATGATGATGG + Intergenic
904439270 1:30519346-30519368 GATGATAAAGAGGATGATGATGG + Intergenic
904439271 1:30519364-30519386 GATGGAGAGAATGATGATGAAGG + Intergenic
904463227 1:30692729-30692751 GAAGAAGAGAGGGAGGAGGAGGG + Intergenic
904630168 1:31835193-31835215 GCTGAAGAGGAGGAAGAGGAGGG + Intergenic
904683914 1:32247461-32247483 GAGGACGAGGAGGATGAGGAGGG + Exonic
904904223 1:33882840-33882862 GAAGAAAAGGAGGAAGAGAAGGG - Intronic
904945315 1:34194932-34194954 GATGAAGAGGAAGAAGAGGAGGG + Intronic
905150823 1:35926009-35926031 GCTGAAAAGAAGCATGGGGCTGG - Exonic
905416226 1:37806500-37806522 GCTGTAAAGAAAGATGAAGAAGG - Intronic
905587664 1:39133508-39133530 GATGAGGAGGAGGACGAGGAAGG - Intronic
905970277 1:42136689-42136711 GGAGAAGAGAAGGAGGAGGAGGG - Intergenic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906668095 1:47635818-47635840 GAAGAGAAGGAGGAGGAGGATGG - Intergenic
906712581 1:47942155-47942177 GAACAAAAGAAGGAAGAGGAAGG - Intronic
906832455 1:49047618-49047640 CATGTACAGAAGGATCAGGAGGG - Intronic
906945807 1:50293199-50293221 AAAGAAAAGAAGGCAGAGGAAGG + Intergenic
907012427 1:50976973-50976995 GATCAAAAGAACGTTGTGGATGG + Intergenic
907114238 1:51955125-51955147 GATGACAAGAAGGAGAGGGAGGG - Intronic
907342070 1:53742299-53742321 AATTAGGAGAAGGATGAGGATGG - Intergenic
907654405 1:56327511-56327533 GATGAAAACGGGGATGTGGATGG + Intergenic
907703223 1:56810018-56810040 GAGAGAAAGAAGGAGGAGGAAGG + Intronic
907853820 1:58281943-58281965 GATGATAACAATGATGATGACGG - Intronic
907861680 1:58359793-58359815 GATGATAACAAAGATGATGATGG + Intronic
907901332 1:58744135-58744157 GAGTAAAAGAAGGGTCAGGATGG - Intergenic
908333692 1:63097939-63097961 AAGGAAAAGAAGGATGGGGGAGG + Intergenic
908397786 1:63742095-63742117 GAAGAAAAGGAAGAGGAGGAAGG + Intergenic
908818682 1:68059668-68059690 GAAAAAAAGAATGAAGAGGAAGG + Intergenic
909392856 1:75136169-75136191 GAAGAAAAGAGGATTGAGGAGGG - Intronic
909421781 1:75475305-75475327 AAGGAAAGGAATGATGAGGAAGG + Intronic
909604958 1:77498736-77498758 TGAGAAAAGGAGGATGAGGATGG + Intronic
909615041 1:77598370-77598392 GCTGAGGAGAAGGAAGAGGAGGG + Intronic
909962485 1:81863581-81863603 GATGAAAAGATGGCAGATGATGG + Intronic
910101060 1:83577597-83577619 GTTGAAAACAAGAATGAAGATGG - Intergenic
910256469 1:85253122-85253144 GCAGAAAAGAAGGATGATGAAGG + Intronic
910261720 1:85299505-85299527 GATGAAAAGAGGAAAAAGGATGG + Intergenic
910274803 1:85437429-85437451 GAGGAGGAGAAGGAAGAGGAGGG - Intronic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910482505 1:87674061-87674083 GATGAAGATGGGGATGAGGATGG + Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
910547997 1:88440855-88440877 GAGGAAGAGGAGGACGAGGAGGG + Intergenic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911050410 1:93666062-93666084 GATGGAGAAGAGGATGAGGAGGG - Intronic
911391942 1:97256288-97256310 GAGAGAAGGAAGGATGAGGAAGG - Intronic
911705896 1:101012342-101012364 GCAGAAAAGAGGGATGAGGAAGG + Intronic
911781529 1:101885571-101885593 GCTGAGAAGAAGGAAGAGAAGGG - Intronic
911789832 1:102000391-102000413 GATGATGACAAGGATGAGGATGG - Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912074584 1:105856620-105856642 GAAGAAAAGAAGGAGGAGAGAGG - Intergenic
912328038 1:108787407-108787429 GTGGAAAAGAGGGATAAGGAAGG - Intronic
912372898 1:109187443-109187465 TATGAAAAGAAGGATGAATAAGG - Intronic
912497041 1:110098425-110098447 GATAAAAAGAATGGGGAGGAGGG - Intergenic
912635911 1:111292678-111292700 GATGAAAAGAATTATGGAGATGG - Intronic
912667389 1:111594500-111594522 GATGGAAGGAAGGAAGGGGAAGG + Intronic
912680904 1:111728204-111728226 GACTCAAAAAAGGATGAGGATGG - Intronic
912714584 1:111973900-111973922 GATGGAGAGATGGATGAGGCTGG - Intronic
912883018 1:113437790-113437812 GAAGAAAAGAAGAAAGAAGAAGG - Intronic
913083589 1:115413107-115413129 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
913175060 1:116266033-116266055 GCAGATAAGAAGGATGAGGAAGG + Intergenic
913320409 1:117584146-117584168 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
913325915 1:117628855-117628877 GATCAAAGGAATGAGGAGGAAGG - Intergenic
914234951 1:145800871-145800893 GATGAAAAGGAGCTTTAGGACGG + Intronic
914319045 1:146541736-146541758 GATGAGAAGTAGGAGGAGTAAGG + Intergenic
914355084 1:146877908-146877930 GGGGCAAAGAAGGATGAGAAGGG - Intergenic
914457261 1:147847651-147847673 GGTGAAAAGAACGGTGAGGGTGG - Intergenic
914680464 1:149935226-149935248 GAACAGAGGAAGGATGAGGAGGG + Intronic
915104632 1:153526033-153526055 GATGCATTGAAGGATGAGGAGGG + Intergenic
915254550 1:154616391-154616413 GAGGAAAAGAAGGCTCAGGGAGG - Intronic
915301752 1:154955689-154955711 AATGAAAAGAAGGGGGTGGAGGG - Intronic
915799901 1:158779343-158779365 GATGAAAATAAGCAAGAGGCTGG - Intergenic
915897041 1:159820180-159820202 GAGGAAGAGAAAGATGAGGATGG - Intergenic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
915935412 1:160087707-160087729 GATGAGAAGGTGGAGGAGGAGGG + Exonic
916165464 1:161963301-161963323 TATGAAAAGAAGAATGACAAAGG + Exonic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916415381 1:164587858-164587880 GATGAGAAGGAGGATCAGGGAGG - Intronic
916455846 1:164970353-164970375 GGTGAAAAGAAGGATGAGATGGG - Intergenic
916610864 1:166390180-166390202 GATGAGAAAATGGATGAGGAGGG - Intergenic
916726861 1:167531432-167531454 GCTGAGGAGAAGGAAGAGGAGGG + Intronic
916841202 1:168603050-168603072 GAAGAAAACAATGATCAGGATGG + Intergenic
916869865 1:168901899-168901921 GAAGAAGGGAAGGAAGAGGAAGG + Intergenic
916881664 1:169024696-169024718 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
916982379 1:170152730-170152752 GATGAAAAATATAATGAGGAGGG + Intronic
917019109 1:170567207-170567229 GAAGGAAAGAAGGAAGAGGGAGG + Intergenic
917222073 1:172742712-172742734 GATGAATAGATGGATGGGCAAGG + Intergenic
917386512 1:174482122-174482144 GAAGAAAAGAACCATGAGCAAGG + Intronic
917454241 1:175172100-175172122 GATGAAAAGAGAGAAAAGGAAGG - Intronic
917470283 1:175320773-175320795 GAAGGAAAGAAGGAAGGGGAGGG - Exonic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917620123 1:176786933-176786955 GAGGAAGAGGAGGGTGAGGATGG + Intronic
917642187 1:176993774-176993796 GATGAATAAATGAATGAGGAGGG - Intronic
917751324 1:178056274-178056296 AATGAAAGGAAGGATGAGTTAGG + Intergenic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918229486 1:182515055-182515077 GATGAAAAGATGGAAGAGAAAGG - Intronic
918350211 1:183647688-183647710 GATGAAAAGAAGAAGAAGAAAGG - Exonic
918417679 1:184329006-184329028 GAAGAAAAGTAGGATTTGGATGG - Intergenic
918526549 1:185470993-185471015 GGAGAAAAGAAGGAAGAAGAGGG - Intergenic
918545960 1:185684337-185684359 GATGAATAAAAGAATGAGGTAGG + Intergenic
918787917 1:188788765-188788787 GAAGAAAAGAGAGAGGAGGATGG + Intergenic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
918999881 1:191816729-191816751 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
919266784 1:195278488-195278510 AAAGAAGAGAAGGATGAGGAAGG - Intergenic
919429529 1:197475366-197475388 GAAGAGAGGAAGGATGAAGATGG - Intronic
919464956 1:197915819-197915841 GATGAGAAGAAGGGGAAGGAAGG - Intronic
919509802 1:198447746-198447768 GAGGAAGAGAAGGAAGAGAAAGG - Intergenic
919536474 1:198794125-198794147 AATAAAAAGAAGGATAAGGCAGG - Intergenic
919543059 1:198875405-198875427 GAAGAAGAGAAGGAGGAGGAAGG - Intergenic
919756527 1:201069535-201069557 GATGAAGAGCAGGATGAAGTTGG + Exonic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920172374 1:204080075-204080097 GAGGAAAAGAAGGAAGAAGTGGG + Intronic
920458275 1:206117194-206117216 GAGGGAAAGAAGGCTGGGGAGGG + Exonic
920806925 1:209243448-209243470 GCTTGCAAGAAGGATGAGGAAGG + Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
921139503 1:212292987-212293009 GCAGAAAAGAAGGACGAGGAAGG - Intronic
921220238 1:212968585-212968607 GATGACAAGAGGGTTGGGGAGGG - Intronic
921812640 1:219531964-219531986 GAGGAAAAGGAGGAAGAAGAGGG - Intergenic
921866100 1:220089118-220089140 AAAAAAAAGAAGGAGGAGGAAGG + Intronic
922174739 1:223188735-223188757 GAGATAAAGAAGGAGGAGGAAGG + Intergenic
922434137 1:225586284-225586306 GAAGAAAAGAGGGGAGAGGAGGG + Intronic
922776681 1:228217370-228217392 GGAGAAAAGAAGGGTCAGGAAGG - Intronic
922824942 1:228511467-228511489 GAGGGAAAGGAAGATGAGGAAGG + Intergenic
922887058 1:229028282-229028304 GATGGAAGGAAGGAAGGGGAGGG + Intergenic
922913822 1:229239495-229239517 GATGAACTGAAGGATGGTGAAGG + Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923093356 1:230755798-230755820 GAGGAAATGGAGGCTGAGGAAGG + Intronic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
923171029 1:231417569-231417591 GATGAAAACAAGCATAAGCAAGG + Intronic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923453995 1:234146808-234146830 TATGGAAAGAAAGATGAGGCCGG - Intronic
923462590 1:234219992-234220014 GATCAGAAGAAGCAGGAGGAGGG + Intronic
923474827 1:234322532-234322554 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
923536748 1:234858319-234858341 GAAGAAATGAAGGCTCAGGAGGG - Intergenic
923566581 1:235080952-235080974 GAAGGAAGGAAGGAAGAGGAAGG + Intergenic
923827397 1:237515700-237515722 GAAGAGAAGAAGGAGAAGGAGGG - Intronic
924073512 1:240308509-240308531 GCAGAAAAGAGGGACGAGGACGG + Intronic
924268658 1:242309239-242309261 GCAGAAAAGCGGGATGAGGAAGG - Intronic
924314063 1:242777223-242777245 GATGAGAAGGAGGATTCGGATGG - Intergenic
1062833467 10:621566-621588 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1063057044 10:2517030-2517052 AATGGAAAGAAGGAGGGGGATGG - Intergenic
1063225684 10:4013182-4013204 GAGGAAAAGGGGGATGAGGAGGG - Intergenic
1063490728 10:6461123-6461145 GATGAATGGATGGATGTGGATGG - Intronic
1063556298 10:7082786-7082808 GAAGGAAAGAAGGCAGAGGAAGG + Intergenic
1063756224 10:9012225-9012247 GAATAAAGGAAGGAAGAGGAAGG + Intergenic
1063818016 10:9799262-9799284 GCTGAGAAGGAGGAAGAGGAGGG + Intergenic
1063905127 10:10773799-10773821 CATGTGAAGAAGGAAGAGGAGGG - Intergenic
1064008301 10:11715152-11715174 GAGGGAAAGAGGGAGGAGGAAGG + Intergenic
1064154720 10:12894388-12894410 GAGGAAAGGAAGGAAGAGAAAGG - Intergenic
1064312879 10:14227215-14227237 GAAGAGAAGGAGGAGGAGGAAGG - Intronic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1064686504 10:17867258-17867280 GAAGAAGAGGAGGAGGAGGAAGG - Intronic
1064731516 10:18335908-18335930 TTTGAAGAGAAGGATGAGGATGG - Intronic
1064784639 10:18880532-18880554 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1065140390 10:22714132-22714154 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1065204539 10:23344304-23344326 GATGGAAAGGAGGATGGGGAGGG + Intronic
1065375511 10:25036560-25036582 GGTGCAGTGAAGGATGAGGAAGG + Intronic
1065459128 10:25937266-25937288 GATGAAATAAAGGCAGAGGATGG - Intronic
1065623830 10:27610681-27610703 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1065773247 10:29096879-29096901 GTAGACAAGAAGGATGGGGATGG - Intergenic
1065790301 10:29254351-29254373 GAGGAAGAGGAGGAGGAGGATGG + Intergenic
1065966984 10:30778724-30778746 GAGAAGAAGAAGGATAAGGAGGG + Intergenic
1066008568 10:31171070-31171092 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1066473361 10:35720811-35720833 GAGGGAAAGAAGGAAGAAGAGGG - Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1066638960 10:37536467-37536489 GCAGAAAAGACGGATGAGGAAGG + Intergenic
1066716248 10:38289529-38289551 GCAGAAAAGTGGGATGAGGAAGG + Intergenic
1067073430 10:43155741-43155763 GATGAACAAGAAGATGAGGAGGG + Exonic
1067129552 10:43549835-43549857 GATGAAAAGAAGGCCGAGGTAGG - Intergenic
1067292609 10:44955144-44955166 GAAGGAAAGAAGGGGGAGGAAGG + Intergenic
1067368817 10:45662749-45662771 GAATTATAGAAGGATGAGGAGGG - Intronic
1067488897 10:46679238-46679260 GTGGAAAGGAGGGATGAGGAAGG - Intergenic
1067558168 10:47286651-47286673 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG + Intergenic
1067783523 10:49226441-49226463 GATAACAAGAAAGGTGAGGAAGG + Intergenic
1067859224 10:49827496-49827518 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1068139873 10:52992202-52992224 GATGAGAAATAGGATGATGAGGG + Intergenic
1068174004 10:53433487-53433509 GAAGGAAAGAAGGAAGAAGAAGG + Intergenic
1068184699 10:53569797-53569819 GAAGAAAAGAGGGAAAAGGAGGG + Intergenic
1068287465 10:54959147-54959169 GATGAAGAGAAAAAGGAGGAGGG + Intronic
1068357726 10:55931595-55931617 GATGAATAGAATGGAGAGGATGG - Intergenic
1068370493 10:56107159-56107181 GAGGAAGGGAAGGATGAGGTGGG + Intergenic
1068497606 10:57805277-57805299 GATGTGAAGCAGGATGAAGAAGG - Intergenic
1068595103 10:58894802-58894824 GAGTAAAAGAGGGAGGAGGATGG + Intergenic
1068697223 10:59980544-59980566 GAGGAAAAGGAGGTTGTGGAGGG + Intergenic
1068837649 10:61571820-61571842 GAGGAACAGAATGATAAGGATGG - Intergenic
1069180891 10:65357211-65357233 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1069234438 10:66052388-66052410 CTTGAAATGAAGGATGGGGAAGG + Intronic
1069367540 10:67710113-67710135 GAAGAAAGGGAGGAAGAGGAGGG + Intergenic
1069646759 10:70005253-70005275 GAAGAAAGGAAGGAAGGGGAAGG + Intergenic
1069718510 10:70535551-70535573 AAGGAAGAGAAGGAGGAGGAAGG - Intronic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1069792646 10:71032895-71032917 GATGATAACAATGATGATGATGG + Intergenic
1069792666 10:71033069-71033091 GATGATAATAATGATGAAGATGG + Intergenic
1070152905 10:73816117-73816139 GATAAAAATAAGGAAGGGGAGGG + Intronic
1070326114 10:75390371-75390393 GAGGAAGAGGAGGAAGAGGAGGG - Intergenic
1070326137 10:75390445-75390467 GATGAGAAGAAGGAGGAAGAGGG - Intergenic
1070352152 10:75602934-75602956 GGGAAAAAGAAGTATGAGGAGGG - Intronic
1070617621 10:77981147-77981169 GATGACATTCAGGATGAGGACGG + Intronic
1070681304 10:78451302-78451324 GGTGAAGAGAAGGAGCAGGAAGG + Intergenic
1071014052 10:80973716-80973738 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1071088426 10:81891513-81891535 GATGAACACAAGGAAGATGAGGG + Intronic
1071207552 10:83298807-83298829 GAGGAAAAGAAGGAAGAGAATGG + Intergenic
1071503935 10:86221885-86221907 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG + Intronic
1071868860 10:89769332-89769354 GCAGAAAACAGGGATGAGGAAGG - Intronic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1072208640 10:93226227-93226249 GATGAATTGAAGGATGGTGAAGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072428495 10:95350905-95350927 GATAAAATGCAGGATGTGGAGGG + Intronic
1072619296 10:97068927-97068949 GATGATAACAAGGATTAGGCAGG - Intronic
1072785000 10:98273404-98273426 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1072834353 10:98695270-98695292 GAGGAGAAGGAGGACGAGGACGG + Intronic
1073109249 10:101050945-101050967 GAAGACAAGAAAGATGAGGTGGG - Intergenic
1073119697 10:101113958-101113980 GAAGGAAAGAAGGAAGGGGAGGG + Intronic
1073680929 10:105702731-105702753 TATGACAAGAAAGAAGAGGAAGG - Intergenic
1073731354 10:106291997-106292019 GAAGGAAAGAAGGAGAAGGAAGG + Intergenic
1073835156 10:107432770-107432792 GATGAAAATAATAATGATGACGG - Intergenic
1073920044 10:108448382-108448404 GATGGAAAAGAGGAAGAGGAGGG + Intergenic
1073947612 10:108769003-108769025 TATGAAAGTAGGGATGAGGAGGG - Intergenic
1074002399 10:109386608-109386630 GAAGGAAAGAAGGAAGATGAGGG + Intergenic
1074379589 10:112968293-112968315 GAGGAAGAGAAGGAAGAGAAGGG - Intronic
1074435089 10:113427033-113427055 GATGAAAAGAAGGAAGCAGTTGG + Intergenic
1074561884 10:114542520-114542542 GAAGAAAGGAAGAAGGAGGAGGG + Intronic
1074651409 10:115527844-115527866 GAAGGAAGGAAGGATAAGGAAGG - Intronic
1075025890 10:118982744-118982766 GAGGAAATGAAGGCCGAGGAAGG + Intergenic
1075581692 10:123623622-123623644 GATGACGAAAAGGATGAAGAAGG + Intergenic
1075599990 10:123760784-123760806 GATGAAGAGGAGGAGGAGGATGG - Intronic
1075622288 10:123936822-123936844 GAGGAAGAGGAAGATGAGGAAGG - Intronic
1076076445 10:127537498-127537520 GAGGCACAGAAGGAAGAGGAAGG + Intergenic
1076091347 10:127689037-127689059 GAAGAAGAGGAGGAAGAGGAGGG + Intergenic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076318947 10:129564389-129564411 GAGGAAGAGAAGGAGGAGGAGGG - Intronic
1076323714 10:129604147-129604169 CATGCAAACAAGGAGGAGGATGG - Intronic
1076364242 10:129911611-129911633 GATGGGAAGAGGGGTGAGGAGGG + Intronic
1076623914 10:131810167-131810189 GAGGAAAAGCAGGATGATGGAGG + Intergenic
1076964989 11:75684-75706 GAACAAAAGAAGGAAGAAGAGGG + Intergenic
1077109722 11:856759-856781 AATCAAAAGCAGGATGAGCAGGG - Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077165863 11:1137999-1138021 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1077385106 11:2265723-2265745 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1077663364 11:4088487-4088509 GATGAAAATGAGAATGAGAATGG - Intronic
1078166984 11:8895642-8895664 GATGAAAAGAAGTATAGAGATGG + Intronic
1078184503 11:9040356-9040378 GATCACAAGAAGGGTGAGTACGG - Intronic
1078246075 11:9574042-9574064 GAAGAAGAGGAGGAGGAGGAGGG + Exonic
1078417528 11:11178091-11178113 AATGAAAATGAGGAAGAGGATGG - Intergenic
1078442253 11:11377788-11377810 GAGGAAAAGACAGATGAGGATGG + Intronic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078895868 11:15596631-15596653 GGAGAAAAGAAAGAAGAGGAAGG + Intergenic
1079050125 11:17147819-17147841 GATGAAGACAAAGATGAAGAAGG + Intronic
1079153802 11:17925438-17925460 GAAGAAAAGAAGGGTGAAAAAGG + Intronic
1079283295 11:19107096-19107118 AATGAAAAGAAAGCTGAGGGTGG - Intergenic
1079349457 11:19680196-19680218 GATGAAAAGAATGATGTGCTGGG - Intronic
1079602742 11:22329470-22329492 GATGGAAAGAGAGATGAAGAGGG + Intergenic
1079691156 11:23418975-23418997 GATGATGAGGAGGAGGAGGATGG + Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1079958451 11:26892922-26892944 GATGACTAGAAGGAGGAGGCAGG - Intergenic
1080121739 11:28685736-28685758 GCTGAGGAGGAGGATGAGGAGGG + Intergenic
1080230239 11:30012266-30012288 GAGGAAGAGGAGGAAGAGGAGGG - Exonic
1081057853 11:38432276-38432298 GATGAGGAGGAGGATGAGGAGGG + Intergenic
1081389156 11:42508532-42508554 GATGAAGAGGAGGAAGAGGAGGG - Intergenic
1081434527 11:43012406-43012428 GATGAGATGAAGAATGAGAACGG + Intergenic
1081645589 11:44788032-44788054 GATGAAGAAAAGGTTGAGCATGG + Intronic
1081700600 11:45150206-45150228 GATGTGAAGATGGAGGAGGAAGG - Intronic
1081827837 11:46074839-46074861 GTTGAAAATAAGTCTGAGGACGG + Intronic
1081830536 11:46108615-46108637 GTTTAAAAGTAGGATGAGAACGG + Intronic
1081973488 11:47215903-47215925 TAGGAAAAGAAGGAATAGGAAGG - Intronic
1082079445 11:48000741-48000763 GAGGAAATGAAGGAGGATGATGG - Intronic
1082663064 11:55938492-55938514 CATGAAAGCAAGCATGAGGACGG + Intergenic
1082669795 11:56020878-56020900 GAGGAAGAGCAGGAGGAGGAGGG + Intergenic
1082677940 11:56131591-56131613 GAGTAGAAGAAGGGTGAGGAGGG + Intergenic
1082680799 11:56166550-56166572 AAGGAAAAGATGGATGAGAAGGG - Intergenic
1083050085 11:59769274-59769296 GAGGAGGAGGAGGATGAGGATGG + Intronic
1083162030 11:60860327-60860349 CATGAAAAGAGGGAGGGGGAAGG - Intergenic
1083411561 11:62496843-62496865 GAAGAAAGGAAGGAAAAGGAAGG + Intronic
1083571965 11:63765842-63765864 GAAGAAGAGGAGGAGGAGGAGGG - Exonic
1083759044 11:64805920-64805942 GAAGAAAGCAAGAATGAGGAGGG + Intronic
1083855357 11:65390537-65390559 GGTGGAGAGAAGGATGAGGGTGG - Intronic
1084635491 11:70389647-70389669 GTAGAAAAGAGGGATAAGGAAGG - Intergenic
1084697478 11:70764313-70764335 GATGGATAGAAGGAGGAGGGAGG - Intronic
1084732652 11:71083297-71083319 GATGACAATGAGGATGATGATGG + Intronic
1084896700 11:72276613-72276635 GATGAAAAGAATTATGAAGATGG - Intergenic
1084929830 11:72546142-72546164 TGTGAACAGAAAGATGAGGAAGG - Intergenic
1085106201 11:73845450-73845472 GATGAAAAGCATGATGGAGATGG - Intronic
1085776179 11:79368791-79368813 GATGACAACAATGATGACGATGG - Intronic
1086267674 11:85020791-85020813 GATGAAAAAGAGGCTGAGGAAGG - Intronic
1086463161 11:87025714-87025736 GATGAAAAAGAGGCTGAGGAAGG + Intergenic
1086499200 11:87434943-87434965 GGGGAAAAAAAGGATGATGATGG - Intergenic
1086598182 11:88600238-88600260 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1086871451 11:92042262-92042284 GATGAAGAGAAGGAAGAGCATGG - Intergenic
1086906381 11:92422698-92422720 GCTGAAAAGAAGGCTGAAGGTGG + Intronic
1086947347 11:92856180-92856202 GATGAAAAGGAGCATGATCATGG + Intronic
1086952596 11:92906235-92906257 GAGGAAAAGGAAGAGGAGGAGGG + Intergenic
1086966962 11:93038489-93038511 GATGAGGAGAAGGAGGAGGAAGG - Intergenic
1086987893 11:93269927-93269949 GAAGAAATGAAGGCTCAGGAAGG + Intergenic
1087118731 11:94550598-94550620 GAGGAAAAGAAAGATGGGGGTGG + Intronic
1087134203 11:94698671-94698693 GATAACATAAAGGATGAGGAGGG + Intergenic
1087175875 11:95094698-95094720 AATGAAAAGAAGGCTGAGGTTGG - Intronic
1087417931 11:97882513-97882535 GAAGAAGGGAAGGAAGAGGACGG - Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087601610 11:100323634-100323656 GATGAAAAGAAGGGGGGGGGAGG - Intronic
1087602969 11:100339294-100339316 GATGAACTGAATGATGGGGAAGG + Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087952303 11:104237829-104237851 GATGAACAGAAAGATGAGATAGG - Intergenic
1087981124 11:104615931-104615953 AAAGAAAAGAAAGAGGAGGAAGG - Intergenic
1088033131 11:105276644-105276666 GCTGAAGAGAAGGAGGAAGAGGG + Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088222511 11:107584608-107584630 GATGAATGGATGGATGATGAGGG - Intergenic
1088341087 11:108767915-108767937 GCTGAACAGAAGGAAGAAGAAGG - Intronic
1088446939 11:109941020-109941042 TTTGAAAACAAGGAGGAGGAAGG + Intergenic
1088645450 11:111913216-111913238 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1088696035 11:112366638-112366660 GAAGAAAAGAAGGAAGAAGGGGG - Intergenic
1088707225 11:112474733-112474755 GAAGAAATGAAGGATGGAGAAGG - Intergenic
1088976541 11:114821388-114821410 GAGGAAAAGAAGGAAGAAGGAGG - Intergenic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089170182 11:116506421-116506443 GAAGAAGAGAAAGATGAGGAGGG - Intergenic
1089225561 11:116917805-116917827 GAAGGAAAGAAGGAAGAAGAAGG + Intronic
1089231405 11:116980332-116980354 GCGGAAAAGAGGGTTGAGGAAGG - Intronic
1089369443 11:117944603-117944625 CACGGAAAGAAGGACGAGGAAGG + Intergenic
1089380906 11:118030752-118030774 GAGCCAAAGCAGGATGAGGAGGG + Intergenic
1089406503 11:118202029-118202051 GAAGGAGAGAAGGCTGAGGATGG + Intronic
1089712589 11:120326175-120326197 AAAGAAAAGAAGGAAGAGGAAGG - Intronic
1089714517 11:120345172-120345194 AACGGAAAGAGGGATGAGGAAGG + Intronic
1090087687 11:123665265-123665287 GATGAAAAGAGGAAAGAGAAGGG + Intergenic
1090260046 11:125312933-125312955 GATGAACAGAGGCATAAGGAAGG + Intronic
1090502954 11:127279687-127279709 GAAGAAGAGAAGGAGGAGGAGGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090620604 11:128557649-128557671 GAAAAAAAGAAAGTTGAGGATGG - Intronic
1090685966 11:129119901-129119923 GAAGAGAAGAAAGATGAGGTCGG + Intronic
1090746288 11:129707730-129707752 GCGGAAAAGTGGGATGAGGAAGG + Intergenic
1090862442 11:130666106-130666128 GAGGAAAAGGAAGACGAGGAGGG - Intergenic
1090976841 11:131686514-131686536 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091551209 12:1536209-1536231 GATGAAGGGAAGGAAGAGGGAGG + Intronic
1091653415 12:2326152-2326174 GAGAAAAAGGAGGATGACGAGGG + Intronic
1091794020 12:3287119-3287141 GAACAAAATCAGGATGAGGATGG + Intergenic
1091909175 12:4214903-4214925 GATGAAACTGAGGATTAGGAAGG + Intergenic
1092041241 12:5386542-5386564 GAGGAAAAGGAGGAGGATGAAGG - Intergenic
1092060657 12:5547815-5547837 GATCACAGGAAGGATGAGGGGGG + Intronic
1092173943 12:6390359-6390381 GAAGAGAGGAAGGATGGGGAGGG + Intronic
1092694775 12:11158986-11159008 AATAAAAAAAAGGAGGAGGAAGG + Intronic
1092737627 12:11598238-11598260 GATGGAAAGAAGGAGAGGGAAGG + Intergenic
1093591498 12:20907392-20907414 GAAGGAAAGAAGGAAGGGGAGGG - Intronic
1093622769 12:21312072-21312094 GAAGAAGAGGAGGAGGAGGAAGG + Intronic
1093706277 12:22277881-22277903 GAAGAAAAGAAGCAGGAGAAAGG + Intronic
1093754953 12:22842136-22842158 GAAAAAGAGAAGGAGGAGGAGGG - Intergenic
1093754958 12:22842158-22842180 GAAAAAGAGAAGGAGGAGGAGGG - Intergenic
1093754963 12:22842180-22842202 GAAAAAGAGAAGGAGGAGGAGGG - Intergenic
1093795126 12:23301975-23301997 GAGGAAAAGAATGAAGAGGGAGG - Intergenic
1093869230 12:24266916-24266938 GGTGAATAGAAGTAGGAGGAGGG - Intergenic
1093881142 12:24405835-24405857 GATCAACAGAAGGGAGAGGAGGG + Intergenic
1093994302 12:25625261-25625283 GTTGAAACCAAGGATGAGGCAGG - Intronic
1094030326 12:26004711-26004733 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094132332 12:27087538-27087560 GATGAAAGGAAGGAAGGAGAAGG - Intergenic
1094199736 12:27783261-27783283 GAGGAAAAGGAGGTAGAGGAAGG + Intronic
1094213335 12:27915640-27915662 TAGGAAAAGAAGTATGAGAATGG - Intergenic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1094619254 12:32064580-32064602 GAGGAAGAGAAGGAGGAGGAAGG + Intergenic
1094633254 12:32198747-32198769 GCTGGCAAGAAGGATGTGGAAGG - Intronic
1094636710 12:32233528-32233550 GAAGGAAGGAAGGAGGAGGAAGG - Intronic
1094639604 12:32261298-32261320 GAAGAAAAGAAGAAATAGGAAGG - Intronic
1094788123 12:33874986-33875008 AATAAAAAGATGGAAGAGGAAGG + Intergenic
1095045150 12:37494513-37494535 GAGGAAAAGAAGGAAGAGAGTGG - Intergenic
1095300411 12:40578086-40578108 GGAGAAAAGAAGGAGGAGGAAGG - Intergenic
1095912087 12:47438328-47438350 GAAGGAAGGAAGGAAGAGGAAGG + Intergenic
1096081693 12:48837579-48837601 AATGGAAATGAGGATGAGGAAGG - Exonic
1096517629 12:52165835-52165857 GATGAGGAGAAGGAGCAGGAGGG + Intergenic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1096814857 12:54195703-54195725 AAGAAAGAGAAGGATGAGGAAGG - Intergenic
1097098110 12:56566094-56566116 CATTAAAAGGAGGGTGAGGATGG - Intronic
1097277852 12:57825345-57825367 GATGAAAGCTGGGATGAGGAAGG - Intronic
1097299702 12:58005000-58005022 GATTAAAAAAGGGATGGGGAAGG + Intergenic
1097306861 12:58078957-58078979 GATGAAAAGAATGGGCAGGAGGG - Intergenic
1097677113 12:62614801-62614823 AAGAAAAAGAAGGAAGAGGAAGG - Intergenic
1097744092 12:63280576-63280598 GATAAAGAGAAGGAGGAGGCAGG + Intergenic
1097788568 12:63789027-63789049 GCAGAAAAGAGGGATAAGGAAGG + Intronic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1097989945 12:65824295-65824317 GAAGAAAAGTATGAGGAGGAGGG - Exonic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098037375 12:66318009-66318031 GAATGAAAGAAGGATGAGGAAGG + Intronic
1098061041 12:66563001-66563023 GCTGAGGAGAAGGAAGAGGAGGG + Intronic
1098239172 12:68448874-68448896 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1098284816 12:68896253-68896275 GCTGAGCAGAAGGATCAGGAAGG - Intronic
1098290254 12:68951417-68951439 AAGGAAAAGAAGGAGTAGGATGG + Intronic
1098301904 12:69063007-69063029 GACAAAAAGAAGGATAAAGAGGG - Intergenic
1098353915 12:69591797-69591819 GCAGAAAAGAGGGAGGAGGAAGG - Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098513317 12:71344732-71344754 GAGGAAGAGGAGGAAGAGGAAGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098867679 12:75781345-75781367 GATGAAAAGATGGAGGGGGAAGG + Intergenic
1099146393 12:79050306-79050328 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1099163849 12:79276968-79276990 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1099241234 12:80141965-80141987 CAAGAAAGGAAGGTTGAGGATGG - Intergenic
1099284351 12:80697640-80697662 GAGTAAAAGAAGGAGGAAGAGGG - Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099491056 12:83288548-83288570 GCTGAAGAGAAGAAAGAGGAGGG - Intergenic
1099600261 12:84726571-84726593 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1099879055 12:88444359-88444381 AAAAAAAAAAAGGATGAGGATGG + Intergenic
1100201249 12:92299923-92299945 GAAGAGGAGAAGGAGGAGGAGGG + Intergenic
1100209307 12:92385151-92385173 GATGAAAAGAGGGAAGAATAAGG - Intergenic
1100427242 12:94498785-94498807 GAAGAAAAGGAGGATGGGGTTGG + Intergenic
1101084893 12:101225921-101225943 GAGGAGGAGAATGATGAGGAGGG - Intergenic
1101168304 12:102061949-102061971 GCTGAGGAGATGGATGAGGACGG - Exonic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101428389 12:104606325-104606347 GATGAGGAGGAGGATGAGGAGGG + Intronic
1102531154 12:113547462-113547484 GAAGCAGAGAAGGCTGAGGAGGG + Intergenic
1102544166 12:113642673-113642695 GAGCAAAGGAAGGAAGAGGAAGG - Intergenic
1102568525 12:113812875-113812897 GATGAAGTGAAGGCTGAGAATGG - Intergenic
1102687104 12:114733896-114733918 AGTGAAAAGAAGGCTGAGCATGG - Intergenic
1102725165 12:115057432-115057454 GCTGAAAAAAAGGGTGAGGTGGG - Intergenic
1102733550 12:115136748-115136770 GAAGAAGAAAAGGAGGAGGAAGG + Intergenic
1102746235 12:115251366-115251388 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102746249 12:115251457-115251479 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103022639 12:117548324-117548346 GAGGAAAAGGAGGAAGAGGAGGG - Intronic
1103180553 12:118907548-118907570 GAAGAGTAGAAGGAAGAGGAGGG + Intergenic
1103235392 12:119368216-119368238 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1103245753 12:119455808-119455830 GAAGAAGAAAAGGAGGAGGAAGG + Intronic
1103516208 12:121509928-121509950 GAGGAGGAGAAGGACGAGGAGGG - Exonic
1103917820 12:124385040-124385062 GAGGAAGGGAAGGAGGAGGAAGG + Intronic
1103934414 12:124467771-124467793 GATGAGGATAAGGATGATGAGGG - Intronic
1104241134 12:126990662-126990684 GAAAAAAAGAAGGAAAAGGAAGG - Intergenic
1104316218 12:127704367-127704389 GAAGAAGAGGAGGAGGAGGAAGG + Intergenic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1105609267 13:21954031-21954053 CCTGAAAAGAAGGAGCAGGAAGG - Intergenic
1105892439 13:24691129-24691151 GATGAAGAAAAGGATGCCGATGG - Exonic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106372897 13:29153718-29153740 GAGGAAAAGAAGGATGCAGGAGG - Intronic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106497867 13:30297163-30297185 AAAGAAAAGAAGGAGGAGGAAGG + Intronic
1106900718 13:34352261-34352283 GTGAAAAAGAGGGATGAGGAAGG - Intergenic
1106947044 13:34840213-34840235 GAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1106947064 13:34840311-34840333 GAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107164107 13:37265389-37265411 GAGGAAGAGAAGGAAGGGGAGGG - Intergenic
1107237307 13:38187252-38187274 GATGAAATCAAAGATGAGTAGGG + Intergenic
1107653862 13:42572485-42572507 GAAGAAGAGGAGGAGGAGGAGGG + Intronic
1107771833 13:43795022-43795044 GAAGAAAGGAAGGAAGGGGAGGG + Intergenic
1107906441 13:45065516-45065538 GAAGAGAGGAAGGAAGAGGAAGG - Intergenic
1107925198 13:45253777-45253799 GATAAAAAGAAAGAAGAGGCTGG + Intronic
1108290434 13:48954941-48954963 GCTGAAAAGGAGGCTGTGGAAGG - Intergenic
1108396386 13:49995924-49995946 GATGCAAACATGGATGATGAAGG - Intronic
1108519628 13:51234655-51234677 GATGGAAGGAAGGAGGAGGAAGG + Intronic
1108546893 13:51503891-51503913 GAGGAAATGAAGGAGCAGGAAGG + Intergenic
1108732547 13:53249504-53249526 GACATGAAGAAGGATGAGGATGG + Intergenic
1109217460 13:59605790-59605812 GACGGAAGGAAGAATGAGGAAGG + Intergenic
1109254027 13:60056349-60056371 GATGAAAAGAAGAATAAAGATGG + Intronic
1109378225 13:61525040-61525062 GATAAAAAGATGGAAGAGAAAGG - Intergenic
1109994582 13:70107464-70107486 GATGAAGAGGAAGAGGAGGAAGG + Exonic
1110041291 13:70762383-70762405 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110533451 13:76623597-76623619 GAGAAAGAGAAGAATGAGGAGGG - Intergenic
1110807528 13:79774356-79774378 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1111480895 13:88824930-88824952 GAGAAAAAGAAGGAAAAGGAAGG - Intergenic
1111775663 13:92658667-92658689 GATGCAAAGAAGGAAGAGATAGG + Intronic
1111917037 13:94372042-94372064 GAAGGAAAGAAGGAAGAGAAAGG - Intronic
1111995029 13:95157484-95157506 GAAGAAAGGAAGAAAGAGGAAGG + Intronic
1112117258 13:96369645-96369667 GATGAGCACAAGGGTGAGGATGG + Intronic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112616230 13:101008540-101008562 AATAAAAAGGAGTATGAGGAAGG - Intergenic
1112843610 13:103610437-103610459 GAGGAACAAAAGGAGGAGGAAGG - Intergenic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113010947 13:105765051-105765073 GAGGAAGAAAAGGAGGAGGAAGG - Intergenic
1113095947 13:106663822-106663844 CATGACAAAGAGGATGAGGAAGG - Intergenic
1113111866 13:106831918-106831940 GAAGAAAAGAGGGGTGATGAGGG + Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113180217 13:107616604-107616626 GACTAAAAGAAGGAAGAGTAAGG - Intronic
1113221425 13:108107978-108108000 AAAGAAAGGAAGGAGGAGGAGGG + Intergenic
1113258609 13:108534806-108534828 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
1113317074 13:109192381-109192403 GATGTCAGGAAGGATTAGGAGGG - Intronic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113628124 13:111861541-111861563 GGTTAAAAGAAGGATGAGGGAGG + Intergenic
1113909679 13:113836254-113836276 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1113930258 13:113964618-113964640 GATGAGAAGGGGGAAGAGGAGGG - Intergenic
1114234775 14:20814230-20814252 GATTAACAGAAGGAGGAGGCAGG - Intergenic
1114262365 14:21046933-21046955 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1114282919 14:21211266-21211288 GATGAAAAAGAGGCTGAGGAAGG - Exonic
1114487393 14:23071053-23071075 GAGGAAGAGAAGGAAGACGAAGG + Intronic
1114799384 14:25755718-25755740 AATGAATAGAAGGAAGTGGAAGG + Intergenic
1115113207 14:29849216-29849238 GAGGAAAAGAAAGAGGAGGGAGG - Intronic
1115263456 14:31476429-31476451 GAAGGAAAGAAGAAAGAGGAAGG - Intergenic
1115275594 14:31605788-31605810 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1115283490 14:31691181-31691203 GAGGAAAAGGAGGAAGAGGTGGG - Intronic
1115320420 14:32075154-32075176 GTGGGAAAGAAGGATGCGGAAGG - Intergenic
1115338003 14:32261432-32261454 ACTGAAAGCAAGGATGAGGAAGG - Intergenic
1115440575 14:33430245-33430267 GAGGAAAAGAAGAATGGGGGAGG - Intronic
1115514020 14:34167288-34167310 GCTGGAGAGAAGGATGAGCAAGG - Intronic
1115524112 14:34262353-34262375 GAGGAAAAGAAGGAAGAGATGGG - Intronic
1116095549 14:40362419-40362441 GAGGAAGAGAAGGAAGAGGAGGG - Intergenic
1116129746 14:40839740-40839762 GCTGAGAAGAAGGAGGAGGAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116309415 14:43304201-43304223 GCTGAGAAGAAGGAAGTGGAGGG + Intergenic
1116720270 14:48486896-48486918 TATGAAAAGTAGGCTGAGCATGG - Intergenic
1116723541 14:48531825-48531847 GAAGAAAAGAAGAAGGAAGAAGG - Intergenic
1116859303 14:49980911-49980933 GAAGAGAAGGAGGATGACGAAGG + Intergenic
1116865692 14:50029810-50029832 GATGGACAGAAGGAAGAGGAGGG - Intergenic
1117075318 14:52096864-52096886 GATGAAGAAAAGGAAGAAGAAGG - Intergenic
1117117276 14:52527032-52527054 GATGAAAAGATGCATGGGGCAGG - Intronic
1117207597 14:53460171-53460193 GAAGAAGAGAAGGAAGAGAAAGG + Intergenic
1117315727 14:54568465-54568487 GCCCAAAAGAAGGAGGAGGAAGG - Intronic
1117512335 14:56465527-56465549 GAGGAAAAGATGGATGGGGTGGG + Intergenic
1117553334 14:56858110-56858132 GAGAGAAAGAAGGAGGAGGAGGG + Intergenic
1117644109 14:57833158-57833180 GATGATAACAAGGATGATGATGG - Intronic
1117710348 14:58521926-58521948 GATGAAAAAGAGGCTGAAGAAGG + Intronic
1118416671 14:65544949-65544971 GATGAAAAGAGAGAAGAAGAGGG - Intronic
1118613614 14:67560337-67560359 GTTAAAAAGAATGAAGAGGATGG - Intronic
1118872006 14:69750889-69750911 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1118952511 14:70447192-70447214 GACAAATTGAAGGATGAGGAGGG + Intergenic
1118968938 14:70615323-70615345 GAAGAAAACAAAGATGAGAAAGG + Intergenic
1119019310 14:71093758-71093780 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
1119184772 14:72632620-72632642 GAAGGAAAGAAGCAGGAGGAAGG + Intronic
1119376485 14:74198110-74198132 GATGAGGATGAGGATGAGGAAGG + Intronic
1119484287 14:74978005-74978027 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1119586134 14:75837533-75837555 GATGAAAAGAATTATGGAGATGG - Intronic
1119766494 14:77192835-77192857 GAAGAAGAGGAGGAGGAGGAAGG + Intronic
1119870442 14:78012340-78012362 GAAGGAAAGAAGGAAGGGGAAGG - Intergenic
1119883036 14:78116649-78116671 GATGAGGATAAGGAGGAGGAGGG - Intergenic
1120212750 14:81650140-81650162 GAGGGAATGAAGGTTGAGGAGGG - Intergenic
1120322549 14:82983403-82983425 GATAAAAGGAAGGAGGCGGAAGG - Intergenic
1120512192 14:85428727-85428749 GAAGAAAAGAATGAGGTGGAAGG + Intergenic
1120633240 14:86917230-86917252 TATGAAACCAAGGATGATGATGG - Intronic
1121165549 14:91793285-91793307 GATGGAAAGAAGGAAGTGTATGG - Intronic
1121210907 14:92207417-92207439 GAGGAAGAGAAGGAGGAAGAGGG + Intergenic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121409481 14:93739604-93739626 GGTGGAAAGAAGGAAGAAGATGG + Intronic
1121461127 14:94079474-94079496 GAAGAAGAGGAGGAGGAGGAGGG - Exonic
1121840186 14:97127527-97127549 GAAGGAAGGAAGGAAGAGGAAGG + Intergenic
1122016785 14:98803276-98803298 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1122082414 14:99274709-99274731 GAGGAAAAGGGGGAGGAGGAGGG - Intergenic
1122431419 14:101649833-101649855 GAAGAAAAAAAGAAAGAGGATGG + Intergenic
1122601019 14:102922049-102922071 GATGAATGGATGGATGAGGATGG - Intergenic
1122804337 14:104249052-104249074 GATGACAATAATGGTGAGGACGG - Intergenic
1122847005 14:104505639-104505661 GACAAAAAGAAGAAAGAGGAAGG + Intronic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1123539258 15:21271712-21271734 GAAGAGGAGAAGGAGGAGGAGGG - Intergenic
1123988864 15:25668483-25668505 GAAGAAAGGAGGGATGAGGGAGG - Intergenic
1124725547 15:32153029-32153051 GATGAAAAGAAGGAGAGTGAGGG - Intronic
1124833044 15:33167871-33167893 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1124870767 15:33539902-33539924 GAGGAAGAGAAGGAGAAGGAGGG + Intronic
1124957841 15:34371151-34371173 GGGGAAGAGAAGGAGGAGGAAGG - Intergenic
1125086393 15:35735118-35735140 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
1125181410 15:36884045-36884067 GATGAAAAGAAAGAGGTGGATGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125428526 15:39573665-39573687 GATGAAAAGGAGGAGGAAGAAGG + Intergenic
1125684653 15:41556790-41556812 GAAGAATAGGAGGAGGAGGAGGG + Intergenic
1125817218 15:42596395-42596417 GAGGAAGAGAAGTATGATGATGG + Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126321595 15:47430153-47430175 GAAAAAAAGAAGGATGTGTAAGG - Intronic
1126340618 15:47637029-47637051 GATGAAAAAAAGGCAGAGAAGGG + Intronic
1126540051 15:49812544-49812566 GAGAAAAAGAAGGAAGAGGAGGG - Intergenic
1126917794 15:53484736-53484758 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1127151282 15:56078130-56078152 GAAGAAAAGTGGGATGAGGAGGG - Intergenic
1127574595 15:60278747-60278769 TATGAGAAGAAAGATGAGCAGGG - Intergenic
1127754917 15:62082911-62082933 GAAGACAAAGAGGATGAGGATGG - Intergenic
1128095809 15:64954493-64954515 GAGGAGAAGAAGGAAGAAGAAGG - Intronic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128477537 15:68010102-68010124 GATGAGAGGAGGGATGAGGCTGG + Intergenic
1128532381 15:68463336-68463358 GAGGAGATGAGGGATGAGGAAGG + Intergenic
1128536269 15:68493007-68493029 CAAGAAAAGGAGGATGTGGAGGG + Intergenic
1128577239 15:68784396-68784418 GATGAGGAGGAGGATGAGGATGG - Exonic
1128649563 15:69400714-69400736 GAGGAAAGAAAGGATGAAGATGG + Intronic
1128704580 15:69829227-69829249 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1128783203 15:70376443-70376465 GAAGAAGAGAGGGAAGAGGAAGG + Intergenic
1128943304 15:71805952-71805974 AAAGAAAAGAAGGAAAAGGAAGG + Intronic
1129820381 15:78597499-78597521 GAGGGAAAGAGTGATGAGGATGG - Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1129912188 15:79237143-79237165 GATGAAAAAGAGGCTGAGGAAGG + Intergenic
1130054121 15:80507642-80507664 GAAGAGAAGAAGGCTGAGGTTGG + Intronic
1130140321 15:81220819-81220841 GAAGGAAGGAAGGAGGAGGAAGG + Intronic
1130211886 15:81931635-81931657 GATGAAAGGAAGGAGAAAGATGG - Intergenic
1130226482 15:82062417-82062439 GCTGAAGGGAAGGAAGAGGAGGG + Intergenic
1130608500 15:85339065-85339087 GATGAAATGAAGCATAAAGAAGG - Intergenic
1130796685 15:87217209-87217231 GATAAAGAGAAGGATGACAAAGG - Intergenic
1130859336 15:87872774-87872796 GATGAAGTGAAAGATAAGGAAGG - Intronic
1131084917 15:89567931-89567953 GATAAAATGAAGGCTGAGAATGG - Intergenic
1131312606 15:91304566-91304588 GAGAAAAAGAGGGAGGAGGAAGG + Intergenic
1131339528 15:91584158-91584180 GAGGAGGAGAAGGAAGAGGAGGG - Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131591845 15:93758336-93758358 GAAACAAAGAAGGAGGAGGAAGG + Intergenic
1131597865 15:93816792-93816814 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1131608464 15:93935221-93935243 GATCAAAAGAAGGAGGAGGCCGG + Intergenic
1132443133 15:101887832-101887854 GAACAAAAGAAGGAAGAAGAGGG - Intergenic
1132906027 16:2283252-2283274 GAGGAAGAGCAGGATGAGGTAGG + Exonic
1133460674 16:5983927-5983949 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133816324 16:9200041-9200063 GAGGAAAAGAAGGAAGAAGGAGG - Intergenic
1133882364 16:9794931-9794953 GATGAAGAGGAGGAGGAGGGTGG + Intronic
1134068219 16:11243487-11243509 GATGAAAAAGAGGCTGAGGAAGG + Intergenic
1134332348 16:13262705-13262727 GAAGGAAAGAAGGAAGAGGCAGG + Intergenic
1134417471 16:14056974-14056996 GATGAGAGGAAGGGTGAGAAGGG - Intergenic
1134541480 16:15070401-15070423 AAAGAAAGGAAGGATAAGGATGG + Intronic
1134642881 16:15843392-15843414 GAAGAAAGGAAGGAAGAGGCCGG + Intronic
1134814009 16:17191107-17191129 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135074346 16:19380720-19380742 GATTGAATGAAGGAGGAGGAGGG - Intergenic
1135264374 16:21009938-21009960 GAGGAAAAGAAGGAAGGGAAGGG + Intronic
1135359473 16:21799981-21800003 AAAGAAAGGAAGGATAAGGATGG + Intergenic
1135436940 16:22434958-22434980 AAAGAAAGGAAGGATAAGGATGG + Intronic
1135624878 16:23985772-23985794 GTTGAAAATAAGGATAATGAGGG + Intronic
1135712401 16:24729372-24729394 GCAGCAAAGAAGGAGGAGGAGGG + Intergenic
1135910609 16:26557520-26557542 GAGGAAAAAAAGGAAAAGGAAGG - Intergenic
1135934756 16:26770392-26770414 GAAGAAAAGAAGGAGGAGAAAGG + Intergenic
1135973761 16:27091581-27091603 GAAGAAAAGAAGAAAGAGGATGG + Intergenic
1136078578 16:27836455-27836477 GAAGAAAAGGAGGAAGAGGATGG - Intronic
1136158277 16:28400456-28400478 GATGAGGATGAGGATGAGGACGG - Exonic
1136170349 16:28485726-28485748 GATTAGAAGTAGGATGAGGGTGG - Intronic
1136204810 16:28714827-28714849 GATGAGGATGAGGATGAGGACGG + Exonic
1136959137 16:34825636-34825658 GATGAAAAGAATTATGGAGATGG + Intergenic
1137038068 16:35583961-35583983 TAAGAAAAGGAGGATGAGGCTGG + Intergenic
1137399836 16:48144404-48144426 GGAAAAAAGAAGGAAGAGGAGGG - Intronic
1137557129 16:49477565-49477587 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137557150 16:49477671-49477693 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137557161 16:49477739-49477761 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137598850 16:49742821-49742843 GAAGAAAAGCAGGGAGAGGAGGG + Intronic
1137617498 16:49856230-49856252 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1138153974 16:54685892-54685914 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1138237301 16:55395322-55395344 GAGGAAGAGGAGGAAGAGGAGGG - Intronic
1138384957 16:56629987-56630009 GATGATATGAAGGATGGGAACGG - Intergenic
1138393622 16:56688027-56688049 GATGAAAAGATGAATGACAATGG + Intronic
1138741454 16:59315731-59315753 GATGAACTGAAGGATCTGGATGG - Intergenic
1138775360 16:59716355-59716377 AATGAGTAGAAAGATGAGGATGG + Intronic
1139010485 16:62626406-62626428 GATGATAAGGAGGAGGACGATGG + Intergenic
1139018090 16:62714688-62714710 GAAGAAGAAAAGGAGGAGGAAGG - Intergenic
1139131201 16:64148282-64148304 GAAGAAAAGAAAGAGAAGGAAGG - Intergenic
1139397627 16:66653138-66653160 GAAGTAAAGCAGGAAGAGGAAGG - Intronic
1139821295 16:69723498-69723520 GATCAAAAGAAGGTTGTGGGTGG + Intronic
1139946386 16:70645155-70645177 GAAGAGAAGGAGGAAGAGGAAGG + Intronic
1139978932 16:70837621-70837643 GGGGCAAAGAAGGATGAGAAGGG + Intronic
1139991739 16:70945143-70945165 GATGGCAACAGGGATGAGGATGG + Intronic
1140014476 16:71168348-71168370 GATGAGAAGTAGGAGGAGTAAGG - Intronic
1140024277 16:71270258-71270280 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1140142082 16:72267657-72267679 GATAAAAGGAAGGGTGAGTAGGG + Intergenic
1140453727 16:75092257-75092279 GCTGAAGAGGAGGAGGAGGAGGG + Intronic
1140489380 16:75321619-75321641 GCGGAAAAGAGGGGTGAGGAAGG + Intronic
1140654935 16:77130759-77130781 TATGAAGAGAAGGATGAAGAAGG + Intergenic
1140917315 16:79505922-79505944 AATGGATAGAAGGAAGAGGAAGG + Intergenic
1140965986 16:79966515-79966537 AAGGAAAGGAAGGTTGAGGAAGG - Intergenic
1141230951 16:82167247-82167269 AAGAAAAAGAAGGATGTGGATGG - Intronic
1141346186 16:83248214-83248236 GATGAAAAAAGAGATCAGGAAGG + Intronic
1141477750 16:84284950-84284972 GAGGATAGGAAGGATGAGGCAGG - Intergenic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141714024 16:85716665-85716687 GAGGAAGGGAAGGAGGAGGAAGG + Intronic
1141801263 16:86311012-86311034 GAGAAACAGAAGGAAGAGGAAGG - Intergenic
1141845133 16:86603444-86603466 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845144 16:86603501-86603523 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845155 16:86603558-86603580 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845166 16:86603615-86603637 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845177 16:86603672-86603694 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845188 16:86603729-86603751 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845220 16:86603891-86603913 AAGGAAAGGAAGGAGGAGGAGGG - Intergenic
1142137757 16:88459541-88459563 AATGAAGAGAAGGAGGAGGAAGG - Intronic
1142489376 17:268206-268228 GATGAGGAGGAGGAAGAGGAGGG - Intronic
1142494025 17:296762-296784 TATGAAAAAAAGGGTGTGGAAGG + Intronic
1143035294 17:3991922-3991944 GAAGAAAGGAAGGAAGGGGAAGG - Intergenic
1143270041 17:5668653-5668675 GAAGAGAAGAAAGAGGAGGAAGG - Intergenic
1143391314 17:6560892-6560914 GATGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391499 17:6561549-6561571 GATGAGGAGAAGGAGGAAGAGGG - Intergenic
1143391543 17:6561692-6561714 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1143729114 17:8870363-8870385 GATTAGAAAATGGATGAGGATGG - Intergenic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144136639 17:12301555-12301577 GAGAAAGAGAAGGATGGGGAAGG - Intergenic
1144218925 17:13082627-13082649 CATATAAAGAAGGAGGAGGAGGG + Intergenic
1145747600 17:27331992-27332014 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1146082603 17:29795095-29795117 GATGTAAAGGTAGATGAGGATGG - Intronic
1146110003 17:30080728-30080750 GAGGAAAAAGAGTATGAGGATGG - Intronic
1146191279 17:30769318-30769340 GAAGAAAAGAGGGATGGGTAGGG - Intergenic
1146336443 17:31975967-31975989 GAAGAAAAGAGGGATGGGCAGGG - Intronic
1146435220 17:32839609-32839631 GATGAAGGGAAGCATGGGGAAGG + Intronic
1146548028 17:33755939-33755961 GATGATAAGCAGGGTGGGGAAGG + Intronic
1146667102 17:34712552-34712574 GATGAAAATGTGGGTGAGGATGG - Intergenic
1146689591 17:34864058-34864080 GATGAGAAGGAAGAAGAGGAGGG - Intergenic
1147431587 17:40374687-40374709 GAGGACAAAAAGGAGGAGGAGGG - Intergenic
1147526589 17:41230391-41230413 GAAGAAAGGAAGGAAGAGGAAGG + Intronic
1147536897 17:41327345-41327367 GAAGAAAAGATGTAAGAGGAAGG - Intergenic
1147674318 17:42194205-42194227 GGAGAAAAGAAGGAAGAGGAAGG + Intronic
1148074211 17:44926348-44926370 GATGAAGACAAGAAGGAGGAGGG - Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148574531 17:48700136-48700158 GAAGAAGAGAAGGAGGAGGAAGG + Intergenic
1148787448 17:50152225-50152247 TAGGAAAAGGAGGAAGAGGATGG - Intergenic
1149114172 17:53071751-53071773 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
1149524736 17:57346296-57346318 GTTAAAAATAAGGATGAGAAGGG - Intronic
1149935570 17:60803103-60803125 GACGACATGAAGGATGATGAAGG + Intronic
1150466117 17:65394099-65394121 GGTAAAAAGAAGGTAGAGGAAGG + Intergenic
1150520076 17:65857173-65857195 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1150585066 17:66510082-66510104 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1150643098 17:66962875-66962897 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
1150683722 17:67303612-67303634 AGTGAAAAGAAGGATGATGAGGG + Intergenic
1150719145 17:67599426-67599448 AATGAAAAGAAGGGCAAGGATGG + Intronic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1150919490 17:69468255-69468277 GCTCAAATGAAGGATGAGAAGGG - Intronic
1150919544 17:69468740-69468762 GCAGAAAAGAGGGATGATGAAGG - Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151115101 17:71726694-71726716 GGTGAAGAGAAGGGTGAGGGTGG - Intergenic
1151191752 17:72403751-72403773 GAAGCAAAGAAAGTTGAGGATGG + Intergenic
1151312868 17:73304959-73304981 GATGAGGATAAGGATGAGGTGGG - Intronic
1151441586 17:74132805-74132827 CAAGAAGAGAAGGAGGAGGAAGG + Intergenic
1151550456 17:74819721-74819743 GATGGAAACAAGAGTGAGGAGGG - Intronic
1151826601 17:76527454-76527476 GATGAAGATGAGGATGAGGATGG + Exonic
1151872673 17:76847107-76847129 GAAGAAGAGGAGGAAGAGGAAGG + Intergenic
1152007620 17:77692439-77692461 GCTGAAGAGGAGGATGAGGAGGG + Intergenic
1152297549 17:79476942-79476964 GAAGAAAAGGAGGAGGAGGAAGG + Intronic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152863805 17:82710517-82710539 GAGGACAAGAAGGAGGTGGACGG + Intergenic
1152996919 18:416378-416400 GATGAAAAGCAGGATGAATCAGG + Intronic
1153000753 18:453353-453375 GAAAATGAGAAGGATGAGGAAGG + Intronic
1153151384 18:2097865-2097887 AAAGAAAAGAAAGATGAGGTAGG + Intergenic
1153483299 18:5569509-5569531 GATGAGAGGAAGGATGAGAAAGG + Intronic
1153615770 18:6931599-6931621 GATGGAAAGAGAGAAGAGGAGGG - Intergenic
1153780108 18:8486965-8486987 GATGAGAAGAAGAAAGAGGCAGG - Intergenic
1154031366 18:10756694-10756716 GGAGAAATGGAGGATGAGGAGGG + Intronic
1154032520 18:10766224-10766246 GAGGAACAGGAGGAGGAGGAGGG + Intronic
1154050734 18:10954595-10954617 GATGAGAAGAAGAGGGAGGAGGG + Intronic
1154235760 18:12604040-12604062 GATGAAGAGAAGCATGGGAAAGG - Intronic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1155066654 18:22274124-22274146 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1155304372 18:24464696-24464718 GATGAACAAATAGATGAGGATGG - Intronic
1155393119 18:25358269-25358291 GATCAAAATATGGATGAAGAAGG + Intergenic
1155607118 18:27619470-27619492 GATGGCATGAAGGATGAAGAAGG + Intergenic
1155712964 18:28905254-28905276 GAAGAAAGGAAGGAAGATGAAGG - Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1155886903 18:31218894-31218916 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1156363029 18:36400865-36400887 AAAGAAAAAAAGGATCAGGATGG + Intronic
1156390420 18:36645084-36645106 GAGGAAAAGAAGACTGAGGCTGG + Intronic
1156482660 18:37445881-37445903 GATGATAAGGAGGAGGAGGATGG - Intronic
1156730278 18:40185764-40185786 GAAAAGAAGAAGAATGAGGAGGG + Intergenic
1156735273 18:40250030-40250052 AAAAAAAAGAATGATGAGGATGG + Intergenic
1156765262 18:40645938-40645960 GATGAAAGAAAAGAAGAGGAGGG - Intergenic
1156791769 18:40984132-40984154 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1156894711 18:42232507-42232529 GATGAGTAAAAGGATGAGGGAGG + Intergenic
1157005406 18:43577443-43577465 GAGGGAAAGAAGGAGAAGGAGGG - Intergenic
1157120792 18:44909163-44909185 ATTGAAAGGAAGGATGAGTAAGG + Intronic
1157175364 18:45446927-45446949 GATGAGAAGCAGGGTGGGGAGGG - Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157539089 18:48486501-48486523 GAGGAAGAGCAGGATGAGAAGGG - Intergenic
1157673134 18:49547587-49547609 GAGGTAAAGTATGATGAGGAAGG + Intergenic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1157795362 18:50569619-50569641 GCGGAAAACAAGGATGAGGAAGG - Intronic
1157927456 18:51781816-51781838 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1158087506 18:53670042-53670064 GAGGAAAAGAAGAAAAAGGAGGG - Intergenic
1158196946 18:54897990-54898012 GAGGAAGAGGAGGAAGAGGAGGG + Intergenic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158425680 18:57337983-57338005 GATGACAGCAAGAATGAGGAAGG - Intergenic
1158569712 18:58587504-58587526 GCTGAAAAAAAGTATGAGAATGG + Intronic
1158927311 18:62281015-62281037 GTAGAAAAGAGGGAAGAGGAAGG - Intronic
1159088874 18:63824090-63824112 GATGATAATGAGGATGATGATGG + Intergenic
1159322974 18:66877556-66877578 AATGAAAAGAAAGAGAAGGAAGG + Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159848281 18:73493294-73493316 GAGGAGGAGAAGGAAGAGGACGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160475316 18:79179532-79179554 GATGAAAAGAAGAATCATGAAGG - Intronic
1160641794 19:145314-145336 GAACAAAAGAAGGAAGAAGAGGG + Intergenic
1160695326 19:481207-481229 GATGAGAAGGATGATGGGGAAGG + Intergenic
1160964469 19:1740460-1740482 GAAGAAAACAAGGTTGAGGTGGG - Intergenic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161520983 19:4723471-4723493 GAGGGAAAGAAGGTGGAGGAGGG + Intronic
1161676626 19:5654104-5654126 GATGCTAAGAAGGGTGACGACGG + Exonic
1161727837 19:5940548-5940570 CATGAAAACAAGGGTGTGGAGGG + Intronic
1162053054 19:8046701-8046723 GAGGAGGAGAAGGAGGAGGAAGG - Intronic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162155939 19:8678014-8678036 GATGGATAGATGGATAAGGATGG - Intergenic
1162171753 19:8795251-8795273 GCAGAAAAGAGGGATGAGGATGG - Intergenic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162248967 19:9426414-9426436 GAGGAAAAGAAGGAGGGGTAAGG - Intronic
1162339204 19:10081729-10081751 GAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1162419927 19:10560312-10560334 GAGGAAATGGAGGAAGAGGAGGG - Exonic
1162458590 19:10800803-10800825 AAAGACAAGAAGGATGAGGGAGG + Intronic
1162492070 19:10998816-10998838 GAAGAAAAGTCTGATGAGGAAGG - Intronic
1162778149 19:12992392-12992414 GAAAGAAAGAAGGAAGAGGAGGG - Intergenic
1162809088 19:13153616-13153638 GAAGAAAAGGAAGAAGAGGAGGG + Exonic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1163730460 19:18946438-18946460 AATGAAGAGAAGGAAGAGGGAGG - Intergenic
1163779166 19:19237197-19237219 AAGGAAAAGTAGGCTGAGGATGG - Intronic
1164324601 19:24180503-24180525 GAGGAAGAGAAGGAGGAGGAAGG + Intergenic
1164404544 19:27932349-27932371 GATGAAGAGAAGAAGGAGGAAGG - Intergenic
1164451393 19:28368636-28368658 TATGTAAAGGAGGGTGAGGAAGG - Intergenic
1164700345 19:30280290-30280312 GAAGGAGAGAAGGATGAAGATGG - Intronic
1164706517 19:30324104-30324126 GATGGACAGATGGATGATGATGG - Intronic
1164858638 19:31544969-31544991 GAGAAAGAGAAGGAGGAGGAGGG - Intergenic
1164922398 19:32098521-32098543 GAGGAAGAGGAGGAAGAGGAGGG - Intergenic
1164994323 19:32708499-32708521 TATGGAAAGAAGGCTCAGGAAGG + Intronic
1165428245 19:35757240-35757262 GAGGAAACTAAGGCTGAGGAGGG + Intronic
1165542642 19:36504878-36504900 GATGAAAAGAATTATAAAGATGG - Intergenic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1166167656 19:41003743-41003765 ACAGAAAGGAAGGATGAGGAAGG + Intronic
1166201225 19:41239021-41239043 GATGAAGGGGAGGACGAGGAAGG + Intronic
1166649981 19:44565718-44565740 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1166652187 19:44582857-44582879 GAGGAAGAGGAGGAGGAGGACGG + Intergenic
1166746799 19:45145596-45145618 GAGGAAGAGGAGGAAGAGGAAGG + Exonic
1167056071 19:47112362-47112384 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1167191308 19:47991808-47991830 GAAGAGAGGAAGGAGGAGGAGGG - Intronic
1167202058 19:48072739-48072761 CATGAATAAAAGGAGGAGGAAGG + Intronic
1167269447 19:48499129-48499151 GAAGAAGAGGAGGAGGAGGAGGG - Exonic
1167383987 19:49153511-49153533 GAGGAAGAGGAGGAGGAGGAGGG - Exonic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167775628 19:51552972-51552994 GATGAGCAGGAGGAAGAGGAGGG + Intergenic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1167789365 19:51663512-51663534 GGAGAAAAGAAGAATGAGGCCGG - Intergenic
1167789723 19:51666691-51666713 GATGGAAGGAAGGAAGGGGAAGG + Intergenic
1167983308 19:53294287-53294309 GCAGAAAAGAGGGTTGAGGAAGG + Intergenic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168489661 19:56797644-56797666 GAGGAAGAGGAGGAGGAGGAGGG - Intronic
1168510200 19:56967526-56967548 GACAAAGAGGAGGATGAGGAGGG - Intergenic
1168659395 19:58154627-58154649 AAGGAAAAAAAGGACGAGGAAGG - Intronic
1168725388 19:58578419-58578441 GAAGGAAAGAAGGATGGGAAAGG - Intergenic
925198031 2:1943167-1943189 GATGAGAAGGAGGAGGATGAGGG - Exonic
925306188 2:2849442-2849464 GAAAAAAAGAAGGAGGGGGAGGG - Intergenic
925436903 2:3846257-3846279 GATGAAAAGGAGGAGAAGAAGGG - Intronic
925496202 2:4452379-4452401 GAAGAAGAGAAAGAAGAGGAAGG - Intergenic
925571679 2:5318981-5319003 GATGGAAAGAAAGATGAGGGAGG + Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
925902582 2:8518900-8518922 GATGAAGAGGAGGATAGGGAGGG - Intergenic
926087758 2:10030679-10030701 GATGGAAAGAAGGGGGAGGAGGG + Intergenic
926118954 2:10230748-10230770 GATGAAACGAAGTATGTGAAAGG + Intergenic
926301736 2:11609697-11609719 CATGAAGAAAAGGAGGAGGATGG + Intronic
926591013 2:14740316-14740338 GAAGAAGAGAAGCAGGAGGAGGG + Intergenic
926725487 2:15994246-15994268 GAGGAAAGGAAGGAAGGGGAAGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926957759 2:18320011-18320033 GAAGAAGAGGAGGAAGAGGAGGG + Intronic
927076284 2:19581088-19581110 GATGGAATGCAGGAGGAGGAAGG + Intergenic
927187354 2:20491316-20491338 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
927433034 2:23042937-23042959 GATGGGAAGGAGGATGAAGAGGG - Intergenic
927661898 2:25000590-25000612 GAGGAAAACAAAGATGAAGAGGG - Intergenic
927826873 2:26315466-26315488 GATGAAGGGAAGTAAGAGGAAGG + Intronic
928083104 2:28327240-28327262 GATGAGAAGGAGGAGGAGAAGGG - Intronic
928102962 2:28450104-28450126 GGGGGAAAGAAGGAGGAGGAGGG - Intergenic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928218197 2:29380073-29380095 GAGGAAAAGAGCAATGAGGAAGG + Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928771352 2:34705540-34705562 GAGGAAGAGAAGGAGGAGGAAGG - Intergenic
929066710 2:37983072-37983094 AAAGAAGAGAAGGAAGAGGAGGG - Intronic
929117040 2:38453258-38453280 GGAGAAAAGAAGGAGGAAGAGGG - Intergenic
929651485 2:43684171-43684193 GGAGAAAAGAAGGAAAAGGAAGG - Intronic
929882513 2:45849411-45849433 GAGGAAGAGAATGCTGAGGATGG - Intronic
929912647 2:46103883-46103905 GATGGAAAGGAGGAGGTGGAAGG + Intronic
930297075 2:49568218-49568240 GACCAAAAGAAGGTTGACGATGG - Intergenic
930345184 2:50171121-50171143 GAGGAAGAGAAGGAAGAGGAGGG + Intronic
930411621 2:51032161-51032183 GAGGAGGAGAAGGAGGAGGAGGG + Exonic
930886076 2:56328460-56328482 GTTGAAAGAAAGTATGAGGATGG - Intronic
931458440 2:62430608-62430630 GATGAAAAGAATTCTGTGGATGG + Intergenic
931459725 2:62440152-62440174 GAGGGAAAGAAGGATGAGATGGG + Intergenic
931529399 2:63197148-63197170 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
931871570 2:66466508-66466530 GATGAAAAAAAGGTTTAGAAGGG - Intronic
932128360 2:69165517-69165539 GGAGACAAGAAAGATGAGGAGGG + Intronic
932221323 2:70001459-70001481 GATCAAAATAAGGATGTGGCTGG + Intergenic
932309347 2:70727351-70727373 AATGGAAGGATGGATGAGGAAGG - Intronic
932927351 2:75992125-75992147 CATGCAAATAAGGATGAGAAAGG - Intergenic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933275180 2:80276678-80276700 GAAGAAGAGGAGGAGGAGGAGGG + Intronic
933333867 2:80929337-80929359 GAAGAAGAGAAGGAGAAGGAAGG - Intergenic
933409886 2:81911744-81911766 GAGGAAAGGAAGAAAGAGGAGGG - Intergenic
933462601 2:82607730-82607752 GAGGAGAAGAAGGATTGGGATGG - Intergenic
933619363 2:84519637-84519659 GAAAAGAAGAAGGAAGAGGAGGG - Intronic
933872732 2:86585013-86585035 GTTGAAAGGAAGGATAAGAAGGG - Intronic
933995004 2:87661722-87661744 AAAGAAAAGGAGGAGGAGGAGGG + Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934751977 2:96799490-96799512 GAGGAAACAAAGGATGAGGCAGG - Intronic
934784668 2:96996267-96996289 GAGGAAGAGAAGGAGGAGAAGGG - Intronic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935022337 2:99243802-99243824 GAGGAAATGGAGGTTGAGGATGG + Intronic
935036185 2:99376436-99376458 GAAGAAGAGGAGGAAGAGGAGGG + Exonic
935102152 2:100007038-100007060 GAGGAAGATAAGGATGAGGGGGG + Intronic
935163387 2:100548583-100548605 GCAGAAAAAAGGGATGAGGAAGG - Intergenic
935182319 2:100701988-100702010 GACGAAAAGAAGGAGTGGGATGG - Intergenic
935367116 2:102306328-102306350 AAGCAAAAGAATGATGAGGAAGG + Intergenic
935403420 2:102683801-102683823 GATGAAGAGGGCGATGAGGAAGG - Intronic
935531701 2:104240509-104240531 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935870668 2:107445285-107445307 GAAGGAAAGAAGGGTAAGGAAGG + Intergenic
936115507 2:109699646-109699668 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
936298854 2:111289191-111289213 AAAGAAAAGGAGGAGGAGGAGGG - Intergenic
936558913 2:113519654-113519676 GCTATAAAGAAGGATGAGCAGGG - Intergenic
936704804 2:115059181-115059203 GATAAAAAGAAAGAAGAGGGAGG + Intronic
937025706 2:118695648-118695670 GAAGGAAAGAAGGAAAAGGAAGG + Intergenic
937136635 2:119559179-119559201 GATGAAAAGGAAGTTGAGGGTGG - Intronic
937318153 2:120945073-120945095 GAGGGAAAGAGGGAAGAGGAAGG + Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937412309 2:121687214-121687236 AAAGAAAAGAAAGGTGAGGAGGG - Intergenic
937490232 2:122359471-122359493 GAGGAGAAGACGGAGGAGGAGGG - Intergenic
937525251 2:122760601-122760623 GATGAAATGGAGGCTGGGGAGGG - Intergenic
937545588 2:123014689-123014711 GATGAAAAGAGCGATGAAGGTGG + Intergenic
937546703 2:123030894-123030916 GAAGAGAAGGAGGAAGAGGAGGG - Intergenic
937579086 2:123461538-123461560 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
937969403 2:127537687-127537709 GAAGAAGAGGAGGAGGAGGAGGG + Intronic
938034052 2:128021150-128021172 GATGAAAAGAGTGATGTGGCCGG + Intronic
938272825 2:129990256-129990278 AAGGAAGAGAAGGAGGAGGAGGG + Intergenic
938364545 2:130724496-130724518 GGTGAAGAGGAGGATGATGATGG + Intergenic
938443405 2:131355852-131355874 AAGGAAGAGAAGGAGGAGGAGGG - Intergenic
939534375 2:143408229-143408251 GAAGAAAAGGAGGAGGAAGAAGG - Intronic
940216118 2:151305314-151305336 GATGAAAAGAGAGGAGAGGAAGG + Intergenic
940349515 2:152666253-152666275 AACAAAAAGAAGGATGAAGATGG - Intronic
940678383 2:156752909-156752931 GCAGAAAAGAGGGACGAGGAAGG - Intergenic
940692925 2:156941834-156941856 GATGAGAAGGAGTTTGAGGAGGG + Intergenic
940852205 2:158699156-158699178 GATGAGGAGGAGGAGGAGGAAGG + Intergenic
940920913 2:159305640-159305662 GATGAAAAGAATTCTGGGGATGG + Intergenic
940935695 2:159491909-159491931 AATAAAAAGAAGAATTAGGATGG - Intronic
940971587 2:159902560-159902582 GAAAACAAGAAGGATGAAGATGG + Intronic
941396478 2:164980275-164980297 GAGGAGAAGAAGGAGGAGGTGGG - Intergenic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941701977 2:168613354-168613376 TGTGAAAAGAAGGCTGAGGATGG + Intronic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942232564 2:173873825-173873847 GAAGAGGAGAAGGAAGAGGAGGG + Intergenic
942316802 2:174704432-174704454 GCAGGAAAGAAGGATGAAGAGGG + Intergenic
942347358 2:175017361-175017383 GATGGAAATATGGATGATGAAGG + Intergenic
942602033 2:177651505-177651527 CATAAAAAGAAAGCTGAGGATGG + Intronic
943562431 2:189479815-189479837 AATGAAATGAACAATGAGGAAGG - Intergenic
943601315 2:189924151-189924173 GATGAAAAAGAGGCTGAGGAAGG + Intronic
943975132 2:194466297-194466319 GATGAAAAAGAGGATGAGGATGG + Intergenic
944099098 2:196003177-196003199 GATGGAAAAGAGAATGAGGAAGG + Intronic
944342485 2:198619078-198619100 GAGGAAAATAAGGATAAGAAAGG - Intergenic
945254915 2:207795428-207795450 GATGTCAAGAAGGAAGAGGGAGG - Intergenic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945307077 2:208268772-208268794 GAAGAAAAAGAGGAAGAGGAAGG - Intronic
945711358 2:213300263-213300285 GAGGAAGAAAAGGAGGAGGAGGG - Intronic
945897483 2:215500704-215500726 GAAAAAAGGAAGGAAGAGGAAGG - Intergenic
946316600 2:218919436-218919458 AAAGAAAAGAAGGAAGGGGAGGG - Intergenic
946431563 2:219629341-219629363 GAGGAAGAGGAGGAAGAGGAAGG + Exonic
946488541 2:220125297-220125319 AGTGAAAAAAAGGAGGAGGAGGG + Intergenic
946717076 2:222563921-222563943 GAGGAAGAGAGGGAAGAGGAGGG + Intergenic
947011069 2:225567630-225567652 GAAGAAGAGAAGGAGGAGGAAGG + Intronic
947035615 2:225851081-225851103 GAGGAAGAGGAGGAAGAGGATGG + Intergenic
947154611 2:227149421-227149443 GCAGAAAAGAGAGATGAGGAAGG - Intronic
947350271 2:229236285-229236307 GAGGAACAGAAGGAAGAAGAGGG + Intronic
947382954 2:229563109-229563131 GATGAGGAGGAGGATGATGATGG - Intronic
947382968 2:229563193-229563215 GATGAGGAGGAGGATGATGATGG - Intronic
947382982 2:229563277-229563299 GATGAGGAGGAGGATGATGATGG - Intronic
947970601 2:234319924-234319946 GAAGAGAAGAAGGAGGAGGAGGG - Intergenic
948025781 2:234775092-234775114 GAGGAAGAGAAGGGGGAGGAGGG + Intergenic
948053315 2:234994148-234994170 GATCAATAGAAGGGTGTGGAGGG - Intronic
948331726 2:237172823-237172845 GATGAAAAGAGTTATGATGATGG - Intergenic
948558554 2:238835228-238835250 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
948570869 2:238916429-238916451 GAGGGAAAGAAGGAGGAGGGAGG + Intergenic
948570874 2:238916452-238916474 GAAAGAAAGAAGGAGGAGGAAGG + Intergenic
948720566 2:239897679-239897701 GAAGAAGAGGAGGAGGAGGAGGG - Intronic
949028269 2:241776410-241776432 GAAGAAGAGGAGGACGAGGAGGG + Intergenic
1168864973 20:1078528-1078550 GCTGAAAATCAGGATGAGGAGGG + Intergenic
1168904326 20:1391760-1391782 GAAAAAAAGAGGGAGGAGGAGGG + Intronic
1169434046 20:5569108-5569130 GAAGAAAGGAAGGAAGGGGAGGG - Intronic
1169498940 20:6140937-6140959 GATCTAATGAAAGATGAGGATGG - Intergenic
1169570264 20:6898533-6898555 CATGAAAAGAAGGAGGGAGAGGG + Intergenic
1169646559 20:7816936-7816958 GATGAAGAGAGGAAAGAGGACGG + Intergenic
1169659204 20:7959395-7959417 GAAGAAAATAAAGGTGAGGAGGG - Intergenic
1169939971 20:10926336-10926358 GATGAAAGGAAGGATGGTGGTGG - Intergenic
1169974305 20:11306220-11306242 GATGAAAAGGAAGAGGATGATGG - Intergenic
1170155977 20:13269731-13269753 GAAGAAAAGAAAGAAGATGATGG - Intronic
1170158493 20:13289653-13289675 GAAGAGAAGGAGGAGGAGGAGGG + Intronic
1170288060 20:14734137-14734159 GCTGAAAAAAAGGGTGGGGAGGG - Intronic
1170306472 20:14944221-14944243 GAAGAAAGGAAGGGAGAGGAGGG + Intronic
1170803479 20:19610168-19610190 AATGATAAGAAGGAAGTGGAAGG - Intronic
1170810265 20:19668908-19668930 GAAGAAAGGAAGGAGGAAGAAGG + Intronic
1170879178 20:20279554-20279576 GAGGAAGAGAAGGAAGAGGAGGG + Intronic
1170880969 20:20296241-20296263 GAAGAAAGGAAGGAAGAGGGAGG - Intronic
1171520019 20:25768676-25768698 GGTGTAAGGAAGGCTGAGGAAGG - Intronic
1171556900 20:26087817-26087839 GGTGTAAGGAAGGCTGAGGAAGG + Intergenic
1171940970 20:31329545-31329567 GATGAAAAGACGAATGTGAATGG - Intergenic
1171950158 20:31414247-31414269 GAAGAAAGGAAGGAAGGGGAAGG + Intergenic
1172602586 20:36194265-36194287 GGTGACAAGCGGGATGAGGATGG + Exonic
1172632286 20:36386467-36386489 GAAGAAAAGAGGGATGGGGGAGG + Intronic
1172689579 20:36781237-36781259 GGTTAAAAGAAAGATGAGGCTGG + Exonic
1172736345 20:37128709-37128731 GCGGAAAAGAGGTATGAGGAAGG - Intronic
1172740721 20:37164363-37164385 GAGGAAGAGAAGGAGGAGGGAGG - Intronic
1172780905 20:37436466-37436488 GATGAAAGGATGGACGATGAGGG - Intergenic
1172815820 20:37685137-37685159 GAAGAAGAGGAGGAGGAGGAAGG + Intergenic
1172953013 20:38734104-38734126 GAGGAAGAGAAGGAGGAGAAAGG - Intergenic
1172993237 20:39051101-39051123 GGTGCAAAGAAGGAAGAGGCTGG - Intergenic
1172994952 20:39063878-39063900 GATGAAAAACAGGTTGAGGCCGG - Intergenic
1173043917 20:39491413-39491435 CGAGAAATGAAGGATGAGGATGG + Intergenic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173499242 20:43540324-43540346 GAGGAAGAGAAGGATAAAGAAGG - Intronic
1173550201 20:43927689-43927711 GAAGAAAGGAAGGAAGGGGAAGG - Intronic
1173596010 20:44258710-44258732 GAGGGAGAGAAGGAGGAGGAAGG - Intronic
1173845635 20:46186700-46186722 GATGAGCTGAAGGGTGAGGAGGG + Exonic
1173908410 20:46645600-46645622 GAAGGAAAGAAGGATTAGAAGGG - Intronic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1174306812 20:49619254-49619276 GATGGATAGATGGATGATGAGGG + Intergenic
1174400901 20:50275272-50275294 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1174579826 20:51563413-51563435 GAAGAGGAGAAGGAGGAGGAAGG + Intergenic
1175128014 20:56766886-56766908 GATGCACAGGAGGATGAGGATGG + Intergenic
1175244198 20:57571804-57571826 GTTGAAAAGAGAGCTGAGGAAGG + Intergenic
1175298903 20:57928861-57928883 GGAGACAAGAAGGAGGAGGAGGG - Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1176877337 21:14145654-14145676 GAGGAGAAGAAGGAGGAGAAAGG + Intronic
1176934552 21:14851105-14851127 AAAGAACAGAATGATGAGGAAGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177513683 21:22121463-22121485 GATAAAAAGATGGAAGAGAAAGG + Intergenic
1177618515 21:23556520-23556542 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1177820088 21:26021953-26021975 GATGACGAGGACGATGAGGATGG - Exonic
1178002337 21:28176392-28176414 AATGAAAAGAAGAAGAAGGAAGG + Intergenic
1178135552 21:29622969-29622991 GATCATAAGAAGGAGGATGATGG + Intronic
1178219696 21:30642302-30642324 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1178511574 21:33209565-33209587 GAAAATATGAAGGATGAGGAGGG + Intergenic
1178534163 21:33398893-33398915 GATGGAGAGCAGGGTGAGGAGGG - Intergenic
1178741568 21:35206707-35206729 GAAGGAAGGAAGGAGGAGGAGGG - Intronic
1178982134 21:37273547-37273569 GAGAAAGAGGAGGATGAGGAGGG + Intergenic
1179130766 21:38635137-38635159 GAGGAAGAGAAGGATGAATAGGG + Intronic
1179141138 21:38726527-38726549 GAAGGAAAGAAGGAGGAGGGAGG - Intergenic
1179197923 21:39183306-39183328 GACGAAGAGGAGGAGGAGGAGGG - Exonic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1179611251 21:42552783-42552805 GCTGAAAAGCAGGAAGAAGAGGG + Intronic
1180097445 21:45563962-45563984 AATGAAGATAAGGATAAGGATGG + Intergenic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181122262 22:20679041-20679063 TTTGAAAAGAAGGAAAAGGACGG - Intergenic
1181267160 22:21637041-21637063 GATGAGGACAAGGATGAGGATGG + Exonic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181574430 22:23784648-23784670 GTTTAAAAAAAGGATGCGGACGG + Intergenic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182043666 22:27258021-27258043 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1182151251 22:28028617-28028639 GAAGGGAAGAAGGATGAGGGAGG + Intronic
1182420510 22:30246424-30246446 GAAGAAGAGGAGGAGGAGGAAGG + Intronic
1182508893 22:30804457-30804479 GATGAAATGAAAGAGGAGGGGGG + Intronic
1182724864 22:32436389-32436411 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1183145405 22:35986287-35986309 TATGAACAGCAGGATGAGGAAGG + Intronic
1183162832 22:36126480-36126502 GAAGAAAAGGAGGGAGAGGAAGG - Intergenic
1183162837 22:36126502-36126524 GAAGAAAAGGAGGGAGAGGAAGG - Intergenic
1183162842 22:36126524-36126546 GAAGAAAAGGAGGGAGAGGAAGG - Intergenic
1183162847 22:36126546-36126568 GAAGAAAAGGAGGGAGAGGAAGG - Intergenic
1183162852 22:36126568-36126590 GAAGAAAAGGAGGGAGAGGAAGG - Intergenic
1183162857 22:36126590-36126612 GAAGAAAAGGAGGGAGAGGAAGG - Intergenic
1183162862 22:36126612-36126634 GAAGAAAAGGAGGGAGAGGAAGG - Intergenic
1183162874 22:36126656-36126678 GAAGAAAAGGAGGGAGAGGAAGG - Intergenic
1183162879 22:36126678-36126700 GAAGAAAAGGAGGGAGAGGAAGG - Intergenic
1183887552 22:40897322-40897344 GATGAAAAGATGAAGGAGGCCGG - Intronic
1183902389 22:41016166-41016188 GAAAAAAAGAAGGAAGGGGAGGG - Intergenic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184014807 22:41777990-41778012 GAAGGAAGGAAGGAGGAGGAGGG - Intronic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184437229 22:44486596-44486618 GATGAAGAACAGGATGAGGAAGG + Intergenic
1184449758 22:44575957-44575979 GAGGAAGAGAAGGAGGAGAAGGG + Intergenic
1184463245 22:44652296-44652318 GATGAAGAGGAGGATGAAGAAGG + Intergenic
1184981739 22:48100313-48100335 GAAGAAGAGAAGGAGGAGGAGGG - Intergenic
1185003429 22:48261062-48261084 GATGATAACGAGGAAGAGGATGG - Intergenic
1185015777 22:48341766-48341788 GATGGACAGAAGGAGCAGGATGG + Intergenic
1185015780 22:48341784-48341806 GATGGACAGAAGGAGCAGGATGG + Intergenic
1185015783 22:48341802-48341824 GATGGACAGAAGGAGCAGGACGG + Intergenic
1185055297 22:48575955-48575977 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1185089383 22:48757251-48757273 GATGGGAAGGAGGAGGAGGAGGG + Intronic
1185089412 22:48757352-48757374 GATGGGAAGGAGGAGGAGGAGGG + Intronic
1185097158 22:48816554-48816576 GAGGAAGAGGAGGAGGAGGAGGG - Intronic
1185108576 22:48887978-48888000 GATGAATGGATGGATGGGGATGG - Intergenic
949103082 3:169403-169425 GAAGAAAAGGAGAAAGAGGAGGG + Intergenic
949339349 3:3011907-3011929 GATGAGGATGAGGATGAGGATGG + Intronic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
950239056 3:11351509-11351531 GAGGAAGAGAAGGCTGAGGTGGG + Intronic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950401660 3:12773736-12773758 GAAGAAAAGGAGCAGGAGGAAGG + Intergenic
950626442 3:14250889-14250911 GCGGAAAAGAGGGATGAGGAAGG + Intergenic
950747797 3:15104565-15104587 AATGAGAAAAAGGATGAGGCTGG + Intergenic
951005535 3:17611571-17611593 GAGGAAAAGCAAGATGAAGATGG + Intronic
951092635 3:18592566-18592588 GATAAAAAGAAGGAAGGAGATGG - Intergenic
951118089 3:18889183-18889205 GAAGAAAGGAAGGAGGAGAATGG - Intergenic
951945232 3:28128500-28128522 GATGACATAAAGGATGAGCAGGG - Intergenic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952018380 3:28986913-28986935 GATGAGGAGAAAGAGGAGGAGGG - Intergenic
952107585 3:30087736-30087758 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
952757645 3:36885976-36885998 GATGAAAAAGAAGATGAAGAGGG + Intronic
952798347 3:37263389-37263411 GCGGGAAAGAGGGATGAGGAAGG + Intronic
953242231 3:41159838-41159860 GAAGATAAGAAGGAAGTGGAAGG + Intergenic
953383556 3:42492175-42492197 GAAGGAAGGAAGGATGAGGAGGG - Intronic
953427726 3:42809236-42809258 GATCAATAGGAGGCTGAGGAAGG - Intronic
953771675 3:45782357-45782379 GATGAGTAGAAAGAGGAGGATGG - Intronic
954600467 3:51863615-51863637 GAAGAAAATAAGGCTGGGGATGG - Intergenic
954776425 3:53022812-53022834 GATGAAAAGAGTGATGGAGACGG + Intronic
954778780 3:53045032-53045054 GCTGAAAAGGAGGCTGTGGAGGG - Intronic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
954866640 3:53735418-53735440 GATGAAGACAAGGATGAGGTTGG - Exonic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
955089169 3:55732377-55732399 GATGCAGTGAAGGAAGAGGATGG - Intronic
955191421 3:56765295-56765317 GCGGAAAAGAGGGATAAGGAAGG + Intronic
955458983 3:59158727-59158749 GACTAGAAGAAGGATCAGGAAGG - Intergenic
955662252 3:61313628-61313650 GATGCAAAGAAGAATGACTATGG + Intergenic
956198828 3:66684102-66684124 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
956312788 3:67900264-67900286 GATAAATAAGAGGATGAGGAGGG + Intergenic
956346607 3:68286545-68286567 GATGCAAAGAAGGATTAATAAGG + Intronic
956442885 3:69297447-69297469 GAGGAAAAGAAGGGAGAAGAGGG + Intronic
956457604 3:69438765-69438787 GATGAGTGGAAGGGTGAGGATGG - Intronic
956543949 3:70378442-70378464 TATAGGAAGAAGGATGAGGAAGG + Intergenic
956623577 3:71245380-71245402 GAAAAAAAAAAGGAGGAGGAGGG - Intronic
956664640 3:71631044-71631066 AATGGGAAGAGGGATGAGGAAGG - Intergenic
957166246 3:76677280-76677302 GAGAAGAAAAAGGATGAGGAGGG + Intronic
957652922 3:83032545-83032567 GATGAGAAGAGGGAAGAGGAGGG - Intergenic
957748298 3:84374680-84374702 GAGGAAGAGAAGGATGGAGAAGG + Intergenic
957762635 3:84578153-84578175 GAAGAAGAGGAGGAAGAGGAAGG + Intergenic
957899926 3:86476169-86476191 GAGGAGGAGAAGGAGGAGGAAGG + Intergenic
957944377 3:87043931-87043953 GTGGAAAAGAGGGATGAGAAAGG + Intergenic
958119822 3:89270956-89270978 GCTGAAAAGGAGGAAGGGGAGGG + Intronic
958558775 3:95715362-95715384 GCTGAAAAAAAGTAAGAGGAGGG - Intergenic
958895556 3:99825394-99825416 GAAGGAAAGAAGAAAGAGGAGGG + Intronic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959034657 3:101346937-101346959 GTTTAAAAAAAGGAGGAGGAGGG + Intronic
959098214 3:101980490-101980512 GAAGAAAAGAGGGAGGAGAAAGG - Intergenic
959136958 3:102435148-102435170 GATGAAGGTAAGGTTGAGGATGG + Exonic
959319456 3:104852616-104852638 AATGAAAAAAAGGATGATGTGGG + Intergenic
959413892 3:106061002-106061024 GATGAAACCAGGTATGAGGAAGG - Intergenic
959445700 3:106436037-106436059 GAAGAAAAAAAGAAAGAGGAAGG + Intergenic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
959550623 3:107651933-107651955 GCAGAAAAGAGGGCTGAGGAAGG + Intronic
959563116 3:107805180-107805202 GGGGAAAAAAAGGATAAGGAAGG + Intronic
960331842 3:116369565-116369587 AAAGAAAAGGAGGAAGAGGAGGG + Intronic
960680633 3:120243906-120243928 GAGGGAAAGGGGGATGAGGAAGG - Intronic
960855680 3:122099975-122099997 GATGAATAGGAGGTTGTGGACGG + Intronic
961732409 3:128975571-128975593 GATGAATGGATGGATGGGGATGG + Intronic
961902405 3:130225715-130225737 GAAGAAAGGAAGGACGGGGAGGG + Intergenic
962252485 3:133844639-133844661 GATCAAAAGCAGGACGAGGCAGG + Intronic
962257143 3:133880300-133880322 TAGGAAAAGAAGGCTGAGGCAGG + Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962582579 3:136811723-136811745 GATGCATTGAAGGGTGAGGAGGG + Intergenic
962606912 3:137039908-137039930 GAGGATGAGAAGGATCAGGAGGG + Intergenic
962760044 3:138503121-138503143 GATGAAAAGAATTATGGAGATGG - Intronic
962769714 3:138601016-138601038 GAAGAAGAGAAGGAGGAGGTTGG + Intergenic
962922418 3:139963085-139963107 GATGAGAATGAGGAGGAGGAGGG + Intronic
963062825 3:141238914-141238936 GCTGAGAAGGAGGAAGAGGAGGG + Intronic
963419400 3:145041019-145041041 GATGTAAAGGAGGCTGAGGAAGG - Intergenic
963836828 3:150066690-150066712 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
964067076 3:152593330-152593352 GGAGAAAAAAAGAATGAGGAGGG + Intergenic
964120492 3:153178399-153178421 TAAGAATAGAAGGTTGAGGAAGG + Intergenic
964182251 3:153902904-153902926 AATGAAAAAAAGGACGAGGTTGG + Intergenic
964236436 3:154535923-154535945 GAGGAAAGGAAAGATGGGGAGGG - Intergenic
964261923 3:154849100-154849122 GAAGAGAAGGGGGATGAGGAAGG + Intergenic
964407161 3:156361139-156361161 GATGAGAAGAATGATGAGGGCGG - Intronic
964472791 3:157072159-157072181 AAAGAAAAGGAGGAGGAGGAAGG + Intergenic
964949615 3:162273747-162273769 GATGACTAGAAGGGTGAGGGAGG - Intergenic
965026852 3:163313498-163313520 GAAGGAAGGAAGGAAGAGGAAGG - Intergenic
965172176 3:165279900-165279922 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
965184035 3:165439819-165439841 GATGAGAAGAATGAGGAAGAAGG + Intergenic
965418944 3:168432501-168432523 GAAGAATAGATGGAAGAGGAAGG - Intergenic
965447618 3:168794970-168794992 GAAGTAGAGATGGATGAGGATGG - Intergenic
965553313 3:169992809-169992831 GAGAAAAAGGAAGATGAGGAGGG + Exonic
965691400 3:171360738-171360760 GATGAATAGATGTATGTGGAAGG - Intronic
965882414 3:173401486-173401508 AATAAGAAGAAGGAAGAGGAGGG + Intronic
966087355 3:176084736-176084758 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
966202469 3:177371605-177371627 GCTGGAACTAAGGATGAGGAGGG - Intergenic
966456833 3:180127481-180127503 GAGGAAGAAAAGGAAGAGGAGGG - Intergenic
966842370 3:184100112-184100134 GATGAGATGAAGAATGGGGAGGG - Intronic
966908546 3:184544673-184544695 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
966947909 3:184790271-184790293 GAGAAAAAGAAGGCTGTGGAAGG + Intergenic
967020056 3:185514926-185514948 GATTGGGAGAAGGATGAGGAAGG - Intronic
967132621 3:186486521-186486543 GAAGGAAAGAAGGAAAAGGAAGG + Intergenic
967334627 3:188330023-188330045 GAGAAAGAGAAGGATGGGGAGGG - Intronic
967466412 3:189811193-189811215 GATGAGAAAGAGGATGAGAATGG + Intronic
967910975 3:194542193-194542215 GATGAAAAGATGCATGAGGCCGG - Intergenic
968426118 4:524499-524521 GAGAAAGAGAGGGATGAGGAGGG + Intronic
968924940 4:3542205-3542227 GATGAATGGATGGATGGGGATGG + Intergenic
969113751 4:4859314-4859336 GCGGAAAAGAGGGCTGAGGAGGG + Intergenic
969324442 4:6432895-6432917 GCTGAGGAGAAGGAAGAGGACGG - Intronic
969349070 4:6587674-6587696 AAAGAAATGAAGGATGAGTAGGG - Intronic
969366745 4:6699676-6699698 GATGAAAGAAAGATTGAGGAGGG - Intergenic
969403457 4:6972670-6972692 GCGGAAAAGAGGGATGAGGAAGG + Intronic
969511396 4:7620049-7620071 GAAGAAGAGGAGGAAGAGGAAGG - Intronic
969628518 4:8321314-8321336 GATGATGATAATGATGAGGATGG - Intergenic
969943226 4:10756100-10756122 AATGAAATGAATTATGAGGATGG - Intergenic
970236531 4:13964368-13964390 GCTGAAAAGGAGGAAGAGGAGGG - Intergenic
970260132 4:14215864-14215886 GATGATAAGGAAAATGAGGAAGG + Intergenic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970444159 4:16110142-16110164 GAAGGAAGGAAGGAGGAGGAAGG + Intergenic
970572489 4:17396621-17396643 GATGAAGATGAAGATGAGGATGG + Intergenic
970807141 4:20050239-20050261 GAGGAAAAATAGGAAGAGGAGGG - Intergenic
971036590 4:22700278-22700300 GATGACAAGGAGGATGATAATGG - Intergenic
971147601 4:23995779-23995801 AATGACAATCAGGATGAGGAAGG - Intergenic
971172799 4:24250608-24250630 AGAGAAAAGAAGGAAGAGGAAGG + Intergenic
971445731 4:26746107-26746129 GAAGAAAAGAAGAATGAGTATGG - Intronic
971514355 4:27467954-27467976 AAAGAAAAAGAGGATGAGGAAGG - Intergenic
971633812 4:29031262-29031284 GAGGAGAAGGAGGACGAGGAGGG - Intergenic
971646319 4:29209246-29209268 GAAGAGGAGAAGGAGGAGGAGGG - Intergenic
971754740 4:30692891-30692913 GATGAGGAGGAGGAGGAGGAGGG - Intergenic
972216541 4:36904352-36904374 GAGGAAAAGGAGGAAGATGAAGG + Intergenic
972293249 4:37711678-37711700 GAAGAAAAGAAGAAAGAGAAGGG - Intergenic
972564202 4:40255494-40255516 GATGAAGAGGAGGAAGAGAAAGG - Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973595484 4:52484426-52484448 GAGGAAAAGAAGGAGAAAGAAGG + Intergenic
973865850 4:55112244-55112266 GAGGAAAAGGGGGAAGAGGAGGG - Intronic
974013503 4:56628203-56628225 GATGAAAGGAATGATGATGTTGG + Intergenic
974229244 4:59088853-59088875 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
974322727 4:60372417-60372439 GATGAAAAGAATTATGGGAATGG - Intergenic
974402187 4:61421943-61421965 GATGAATAGATGAATGATGAAGG - Intronic
974543030 4:63263731-63263753 GATTAAAAGAAAAAGGAGGAGGG + Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
974928846 4:68337224-68337246 GATGAAGAGGTGGATGAAGATGG - Exonic
975031453 4:69623158-69623180 GAGGAACAGATGGAAGAGGATGG - Intronic
975036053 4:69684123-69684145 GAGGAACAGATGGAAGAGGATGG + Intergenic
975189998 4:71449436-71449458 AAAGAAAATAAGGTTGAGGATGG + Intronic
975328562 4:73087875-73087897 GGAGGAAAGAAGGATGAAGAAGG + Intronic
975443927 4:74441043-74441065 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
975612027 4:76213250-76213272 GGGTTAAAGAAGGATGAGGAAGG - Intronic
975814039 4:78198725-78198747 GAAGTGAAGAAGGAAGAGGAGGG - Intronic
975964103 4:79948746-79948768 AATGCAAAGAAGGAGAAGGAAGG + Intronic
975969403 4:80015712-80015734 GAAGAGAAGAAGCAGGAGGAGGG + Intronic
975969644 4:80017675-80017697 AATAGGAAGAAGGATGAGGAAGG + Intronic
975991948 4:80266835-80266857 GAAGAAGAGGAGGAGGAGGAAGG - Exonic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976615375 4:87070425-87070447 GATGAAGAAAAGGCTGAGCATGG - Intronic
976685617 4:87811410-87811432 GAAGAAGAGGAGGAAGAGGAAGG + Exonic
976743150 4:88377877-88377899 GATGAAAAGAAGCAGTTGGAAGG - Intergenic
977146596 4:93448942-93448964 GAAGAAAAGAAGGAAGGGAAAGG - Intronic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
977691084 4:99911833-99911855 GATGAAAAGAAGCTCCAGGATGG - Intronic
977858137 4:101920935-101920957 GATAAAGAGAAGAATGAGGAAGG + Intronic
978035903 4:103994590-103994612 GAAAAAAGGAAGGATGACGAAGG + Intergenic
978386910 4:108185727-108185749 GAGAAAGAGAAGGGTGAGGATGG - Intergenic
978518664 4:109596241-109596263 GAAGAAAATAAGGCTGGGGATGG + Intronic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979168818 4:117573086-117573108 GAAGAAAAGAAGCAAGAAGAGGG + Intergenic
979481189 4:121219327-121219349 GAGGAAAAGGAGGAGGAGGGAGG - Intronic
979687252 4:123524506-123524528 GAGGAAAGGAAGAAAGAGGAAGG - Intergenic
979730575 4:124018423-124018445 GAAGTAAAGAAGGAAGAGAAGGG - Intergenic
979900850 4:126216014-126216036 AATGAAAGGAAGGATGACGAAGG + Intergenic
980129395 4:128804179-128804201 GATAAAAAGAAGGGTAAGGTGGG + Intergenic
980190678 4:129520490-129520512 GAAGAAGAGAAGGAGGAGGGAGG + Intergenic
980443363 4:132875975-132875997 GAAGACAAGAAGGAAGAAGAAGG + Intergenic
980487524 4:133478526-133478548 GCTGAGGAGAAGGAAGAGGAGGG - Intergenic
980638408 4:135539517-135539539 AATTAAAAGAAGGATGATAAGGG + Intergenic
981394295 4:144229083-144229105 GATGAAAAAAAGGAGGAGGGAGG + Intergenic
981421913 4:144560628-144560650 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
981499079 4:145428104-145428126 GCTTAAAAGAGGGATGAGAAAGG + Intergenic
981571733 4:146158786-146158808 GATGAAGAAAAGGAAGAGGAGGG - Intergenic
981633763 4:146851466-146851488 GATAAAATGAAAGAAGAGGAGGG - Intronic
981669139 4:147266367-147266389 GAAGAAAAGGAGGAAAAGGATGG - Intergenic
982208613 4:153017324-153017346 GAAGGAAGGAAGGAAGAGGATGG - Intergenic
982404494 4:155004746-155004768 GAAGAAAAGAAGGAAGTGAAGGG + Intergenic
982426533 4:155268721-155268743 AATGAAAGGAAGGAAGAGAAAGG - Intergenic
982610231 4:157564936-157564958 CATGAAATAAAGGATTAGGAAGG + Intergenic
983163684 4:164448661-164448683 GATGACAAGAAGAGTGGGGAAGG - Intergenic
983211403 4:164962135-164962157 GATAAGAAGGAGGATAAGGAAGG + Intronic
983311699 4:166072383-166072405 AAAGAAAAGAAAGAAGAGGAAGG - Intronic
983351243 4:166592901-166592923 GAGGAAAAGAAAGAGGAGGGGGG - Intergenic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983426500 4:167590272-167590294 GAAGGAGAGAAGGAAGAGGATGG + Intergenic
983470939 4:168153343-168153365 GCAGAAAAGAGGGATGGGGAAGG - Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
984149369 4:176107865-176107887 GAAGGAAAGAAGGAAAAGGAAGG - Intronic
984273242 4:177574026-177574048 GAGGAAAAGAAGAATTGGGAAGG - Intergenic
984291325 4:177798510-177798532 TATGAAAAAAGGGGTGAGGAGGG + Intronic
984589925 4:181605948-181605970 GAAGAAAAGGATGATGTGGACGG - Intergenic
984601572 4:181732982-181733004 AAGGAAAAGAAGGAGGAGAATGG + Intergenic
984692891 4:182748646-182748668 AATGAAAAGAGGGATCAGCATGG - Intronic
984778216 4:183502986-183503008 GATGAGAGGAGGGATGAGCATGG - Intergenic
984968494 4:185164598-185164620 GCAGAAAAGAGAGATGAGGAAGG - Intronic
985149123 4:186928410-186928432 GAGGAAGAGGAGGACGAGGAAGG + Intergenic
985189384 4:187355288-187355310 GATGAGAATAAGAATGAGAACGG - Intergenic
985217394 4:187668557-187668579 GAAGGAAGGAAGGAAGAGGAAGG + Intergenic
985784994 5:1888753-1888775 GAGGAAAAGAAGGATGAGCAAGG - Intergenic
985898110 5:2762423-2762445 GAAGAAAAGGAGGAAAAGGAAGG + Intergenic
986009682 5:3700903-3700925 GAAGAAAAGAAGAAGAAGGAGGG - Intergenic
986427071 5:7644267-7644289 GAGGAAATCAAGGAGGAGGATGG - Intronic
986811046 5:11360174-11360196 GAAGAAAAGAGAGATGAAGAAGG + Intronic
987093174 5:14525448-14525470 CATGGGAAGAAGGATGAGGCAGG - Intronic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
987353221 5:17039920-17039942 GAGGAGGAGAAGGAGGAGGATGG - Intergenic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
987756450 5:22102837-22102859 GCTGAACAGAAGGCTGAAGAGGG - Intronic
987839464 5:23204340-23204362 GAGGAAGAGGAGGAAGAGGAAGG - Intergenic
987851281 5:23358664-23358686 GAACAAAAGAAGGACCAGGAAGG - Intergenic
987952942 5:24699805-24699827 GAAGAGAAGAAGGAAGAGAAAGG - Intergenic
988181119 5:27795714-27795736 GAAGAAAAGAAGGATGGAAAAGG - Intergenic
988610893 5:32723886-32723908 GAAGAAAGGAAGGGAGAGGAGGG - Intronic
988620079 5:32814348-32814370 GACCAAAATTAGGATGAGGAGGG - Intergenic
988997025 5:36724619-36724641 GTTGAAAATAAGGAAGAGGGAGG + Intergenic
989114884 5:37942790-37942812 GATGAAAATAAGGGGGAGGGGGG - Intergenic
989274150 5:39567165-39567187 GAAGAAAAGAAAGAAGAGGAGGG + Intergenic
989623576 5:43408737-43408759 GATTAAAGGAATGATGAAGAGGG + Intronic
989970379 5:50517266-50517288 TCTGAAAAGAAAGAGGAGGAAGG - Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990634934 5:57714265-57714287 GATGACGAGAAGGAGGAGGAAGG - Intergenic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
991261878 5:64676692-64676714 AAGGAAAAGAGGGATGAGGAAGG - Intergenic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
992065720 5:73106025-73106047 GATGAAAAGAATTATGAAGATGG - Intergenic
992071701 5:73154704-73154726 GAAGGAAAGAAGGAAGGGGAAGG - Intergenic
992321224 5:75614907-75614929 GAGGAAAAGAATGGTGAGGGAGG + Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992643913 5:78794601-78794623 GGTGATAGGAAGGAGGAGGAGGG + Intronic
992684772 5:79188577-79188599 GAGCAAGAGAAGGAGGAGGAGGG - Intronic
992744741 5:79807975-79807997 GATCAAAAGCAGGAGGGGGAGGG - Intergenic
992962542 5:81970825-81970847 GATGAAAACAAGAATGCGGCTGG - Intergenic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993285817 5:85994604-85994626 GAAAAAAAGAAAGAAGAGGAGGG + Intergenic
993415734 5:87627788-87627810 GAAGAAAGGAAGGAAGAGAAAGG + Intergenic
993568271 5:89502759-89502781 CATGAGAAGAGGGCTGAGGATGG + Intergenic
993625433 5:90219147-90219169 GATGAAAAGACTTATGAAGATGG + Intergenic
993811261 5:92479499-92479521 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
994040649 5:95256203-95256225 AATGAAAAAAAGAATAAGGAAGG + Intronic
994165275 5:96601770-96601792 GATGAAAAGAATTATGATAAGGG - Intronic
994517043 5:100785132-100785154 GAAGGAAGGAAGGAAGAGGAAGG - Intergenic
994781810 5:104098575-104098597 GAGCAAAAAAAGGATGAGGACGG - Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995041994 5:107599276-107599298 GTTGTAAAGAATAATGAGGAAGG + Intronic
995122017 5:108546301-108546323 GAGGAAAAGCAGGATGAGAACGG - Intergenic
995214729 5:109582345-109582367 GAAGAGGAGAAGGAAGAGGAGGG + Intergenic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
995379810 5:111519072-111519094 GCTGAAAAGAGGGAGGAGGTGGG + Intergenic
995404312 5:111776988-111777010 GATGAGGAGGAGGAGGAGGAAGG + Intronic
995740657 5:115352744-115352766 AATGAAAAGCAGGCTGAGCATGG - Intergenic
995752165 5:115463706-115463728 CAAGAAAATAAGCATGAGGAAGG + Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
995823162 5:116261615-116261637 GATAAAAAGAAAGAAGAGGCAGG - Intronic
995844600 5:116480282-116480304 AATGAAACAAAGGGTGAGGAAGG + Intronic
996443396 5:123516054-123516076 GACCAAAAAAAGGATGAAGATGG - Intronic
996514642 5:124356273-124356295 GATTAAAACAATGATGAGAAGGG + Intergenic
996606567 5:125329967-125329989 GAGGAAAAGAAAGAAGAAGAAGG + Intergenic
996802021 5:127414875-127414897 GATGGGAAGAAGGATCAGGGTGG + Intronic
997109875 5:131063298-131063320 GATGAAAAGAGTTATGAAGATGG + Intergenic
997506530 5:134421969-134421991 GAAGAAGAGGAGGAAGAGGAAGG - Intergenic
997506541 5:134422032-134422054 GAAGAAAAGGAGGAAGAGAAAGG - Intergenic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
997775206 5:136597888-136597910 GATGATGAGAATGATGATGATGG - Intergenic
997811872 5:136978667-136978689 GATGACAAAGAGGATGAGGTCGG - Exonic
998194767 5:140058775-140058797 GAGGAAAAGGAGGAAGAGGAAGG - Intergenic
998274370 5:140738306-140738328 AATAAAAAGAAGAATAAGGAAGG - Intergenic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
998472187 5:142391990-142392012 GAGGAAAAGAAGGAAAAGAAAGG - Intergenic
998620413 5:143788454-143788476 AAAGAAAAGAAGAATGGGGAAGG + Intergenic
998699384 5:144680355-144680377 AAGGAAATGAAGGATGGGGACGG + Intergenic
999261530 5:150241631-150241653 GAAGAAAAGAAGGAGGAGAGGGG - Intronic
999267371 5:150275707-150275729 GATGAACAGCTAGATGAGGAGGG + Intronic
999271193 5:150297323-150297345 GAGGAAGAGGAGGAAGAGGAAGG - Exonic
1000120971 5:158197573-158197595 GATGTAGAGAAGGATCAGGAAGG + Intergenic
1000277788 5:159754358-159754380 AATAAACAGGAGGATGAGGAGGG + Intergenic
1000765530 5:165284753-165284775 AATGAAAAGAAAAATGAGGCTGG + Intergenic
1000847551 5:166300367-166300389 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1001013405 5:168118812-168118834 GAGGAAAAGAAAGAGAAGGAAGG - Intronic
1001073957 5:168610232-168610254 GATGAAAGGAGGGAAGATGACGG + Intergenic
1001126653 5:169025476-169025498 GAAGAAAAGAAAGAAGAGCAAGG - Intronic
1001168195 5:169390981-169391003 GATGGTGAGAAGGAGGAGGATGG + Intergenic
1001220076 5:169893011-169893033 AAAGAAATGAAGGAAGAGGAAGG - Intronic
1001817085 5:174678692-174678714 GCCAAAAAGAGGGATGAGGAAGG + Intergenic
1002130783 5:177080232-177080254 GGAGAAATGAAGGCTGAGGAGGG + Intronic
1002187155 5:177459677-177459699 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1002380578 5:178825351-178825373 GATGAGATGGAGGATGAAGAAGG - Intergenic
1002735066 5:181379170-181379192 GAACAAAAGAAGGAAGAAGAGGG - Intergenic
1002749460 6:94952-94974 GAACAAAAGAAGGAAGAAGAGGG + Intergenic
1002893471 6:1357748-1357770 GTTGAAAAGGAGGAAGAGGAGGG - Intergenic
1003015187 6:2462392-2462414 GAAGAAATGAAGGCTAAGGAAGG + Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003232506 6:4267445-4267467 GAGGAAGAGAGGGAAGAGGAGGG + Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003393219 6:5731270-5731292 GAAGAGAAGGAGGAAGAGGAAGG - Intronic
1003420458 6:5953071-5953093 GATGAAAACAAGGAAAGGGATGG + Intergenic
1003516573 6:6823522-6823544 GAAGAAGAAAAGGAGGAGGAGGG + Intergenic
1003767100 6:9250667-9250689 TAGGAAAAGAAGGGAGAGGAAGG - Intergenic
1004163916 6:13239005-13239027 GATGAGGAGGAGGATGATGATGG - Intronic
1004185391 6:13416991-13417013 TATGATAAGAATGATGATGATGG - Intronic
1004449077 6:15727914-15727936 GAGGAAGAGGAGGAAGAGGAGGG - Intergenic
1004462275 6:15848747-15848769 GATGACAAGAAGGATCCGGATGG - Intergenic
1004560910 6:16749653-16749675 CATGAAAAGAAGGCAGACGAAGG + Intronic
1004751596 6:18567516-18567538 GAAGGAAAGGAGGAGGAGGAAGG - Intergenic
1004751931 6:18570936-18570958 GACAAAAAGAAAGATGAAGATGG + Intergenic
1004822132 6:19378772-19378794 GATGGAAAGAATGAAGAAGATGG + Intergenic
1004869529 6:19890730-19890752 GAGGAAAAGAAGAAGGAGAAAGG - Intergenic
1004951753 6:20681028-20681050 AATGAAAACACAGATGAGGAAGG + Intronic
1004971180 6:20912221-20912243 GCTAAAAAGAAAGCTGAGGAGGG - Intronic
1005738007 6:28766913-28766935 GCTTAATAGTAGGATGAGGAGGG + Intergenic
1005850783 6:29819139-29819161 GAAGAAAAGAAGGAAGGGGAAGG - Intergenic
1005853519 6:29841513-29841535 AATGAAAAAGAGGCTGAGGAAGG - Intergenic
1005857662 6:29874853-29874875 GAAGAAAAGAAGGAAGGGGAAGG - Intergenic
1005863418 6:29918656-29918678 GAAGAAAAGAAGGAAGGGGAAGG - Intergenic
1005865819 6:29935208-29935230 GAAGAAAAGAAGGAAGGGGAGGG - Intergenic
1005998121 6:30944224-30944246 GAAGAAAAGAAAGAAAAGGAAGG - Intronic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006373765 6:33660448-33660470 GGAGGTAAGAAGGATGAGGAGGG - Intronic
1006467930 6:34207077-34207099 GATGAACAGAAGGAAGAGGCTGG + Intergenic
1006564421 6:34942834-34942856 AAAGAAAAGAAGGATGGGGAGGG - Intronic
1006947486 6:37794549-37794571 GATGAAGGGAAGAATGAAGAAGG - Intergenic
1006998930 6:38290154-38290176 GAAGAAAGGAAGGGAGAGGAGGG + Intronic
1007402166 6:41609007-41609029 AAGCAAGAGAAGGATGAGGAAGG - Intergenic
1007476566 6:42123489-42123511 GAAGAAAAGAAGAAAGAAGAAGG + Intronic
1007732730 6:43958672-43958694 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1007902017 6:45421932-45421954 GAAGAAAAGAAGGGAAAGGAAGG + Intronic
1008288372 6:49682480-49682502 GAGGAATAGGAGGAGGAGGAGGG - Intergenic
1008518871 6:52344193-52344215 GAAGAAAGGAAGAAAGAGGAAGG + Intergenic
1008554696 6:52663597-52663619 GCTGAAAAGAGGGATGAGGAAGG + Intergenic
1008652067 6:53573841-53573863 ATTTAAAAGAAGGATGAGGCAGG + Intronic
1008680435 6:53866187-53866209 GATTATAAGAAGGGAGAGGAAGG - Intronic
1008935378 6:56986690-56986712 CAAGAAAAGAAGGTGGAGGAGGG - Intronic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009441440 6:63684398-63684420 CTTGAAATGAAGGATGAAGATGG + Exonic
1009592721 6:65693165-65693187 GAAGAAAAGAAAGAGAAGGAAGG - Intronic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1009686813 6:66970080-66970102 GATGAAAAGAAATCTGAAGATGG + Intergenic
1009865947 6:69398165-69398187 CATGAAGAGGAGGATCAGGAAGG - Intergenic
1010744371 6:79544119-79544141 ACAGAAAAGAGGGATGAGGAAGG - Intergenic
1011132131 6:84062724-84062746 GATGTAAAGGATGAGGAGGAGGG - Intronic
1011368307 6:86605017-86605039 GGTGAAGAGAAGGAGGAGGTAGG - Intergenic
1011484715 6:87829849-87829871 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
1011584027 6:88904782-88904804 GACGAAGATGAGGATGAGGATGG - Exonic
1011749901 6:90444719-90444741 GATGAAAACACTGAAGAGGAGGG + Intergenic
1011866280 6:91832627-91832649 GATGAAAATAAAGAGAAGGAAGG + Intergenic
1011955492 6:93019905-93019927 CAGTAAAAAAAGGATGAGGAAGG + Intergenic
1011999888 6:93641059-93641081 GAGGAAAAGGAGGAAGAAGAGGG + Intergenic
1012013070 6:93816820-93816842 GATGAAATGAAGAATTAGCAAGG + Intergenic
1012280437 6:97321741-97321763 AATACCAAGAAGGATGAGGAGGG - Intergenic
1012325973 6:97917969-97917991 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1012423253 6:99087681-99087703 GATGAAAAGATGGAGGAAAAAGG - Intergenic
1012614589 6:101261082-101261104 GATGAGGAGAAGGATCGGGATGG + Intergenic
1012678881 6:102153749-102153771 GAAGAAAAGAGGGAAGAGGGGGG + Intergenic
1012746555 6:103097903-103097925 GTTTAAGAGAAGGGTGAGGAAGG - Intergenic
1013010696 6:106117431-106117453 GCTGAAAAGAAAGAAAAGGAAGG + Intergenic
1013236965 6:108205586-108205608 GAGGAAGAGGAGGAAGAGGAGGG - Intergenic
1013429315 6:110041696-110041718 AATGAACAGAAGCATGAAGAAGG - Intergenic
1013520567 6:110929280-110929302 AATGAAAATAATGATAAGGATGG - Intergenic
1013589714 6:111609799-111609821 GCTGAAAAGCAGCCTGAGGATGG + Intergenic
1013609187 6:111778251-111778273 GAAGAAAAGATGAATGAGGAAGG + Intronic
1013639141 6:112056428-112056450 CATCAAAAGAAGGAGGAGGAGGG - Intronic
1013887497 6:114987987-114988009 GATAAAAAGCAGGCAGAGGAAGG + Intergenic
1013986890 6:116205136-116205158 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1014318329 6:119894464-119894486 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1014374197 6:120651916-120651938 GAAGAAAAGGAGAAAGAGGAGGG + Intergenic
1014528062 6:122524164-122524186 GATGAAGAGGAGGAGGAGGAAGG - Intronic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014886408 6:126786919-126786941 CATGTAAAGAGGGAAGAGGAAGG + Intergenic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015011081 6:128349070-128349092 CATGAAAAGAAGTATGAATAAGG + Intronic
1015220523 6:130799917-130799939 GATGAAAAGAACTATGGAGATGG - Intergenic
1015521885 6:134139899-134139921 GAAGAGAAGGAGGAAGAGGAAGG - Intergenic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016064311 6:139663281-139663303 GAGGAAGAGGAGGAAGAGGAGGG + Intergenic
1016341938 6:143071740-143071762 GAAGAGAAGAAGGAGGAAGAGGG - Intronic
1017032379 6:150235691-150235713 GAAAAAAAGAAGAAAGAGGAGGG - Intronic
1017297204 6:152811910-152811932 AAAGAAAAGGAGGAGGAGGAAGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017575230 6:155794725-155794747 GATTAAAGGAAGGTGGAGGAGGG + Intergenic
1017591039 6:155978209-155978231 GAAAAAAAGAAGGAGGAGTAGGG - Intergenic
1017805175 6:157939638-157939660 GAGAAAGAGAAGGATGAGGGAGG + Intronic
1017825096 6:158075920-158075942 AAAGAAAAGAAGGATGTGCATGG + Intronic
1018252251 6:161882677-161882699 GATGTGAAGATGGATGAAGAAGG + Intronic
1018928786 6:168225898-168225920 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1018960991 6:168448429-168448451 GATGGGGAGAAGGATGAGGATGG + Intronic
1018961017 6:168448516-168448538 GATGGGGAGGAGGATGAGGATGG + Intronic
1018996547 6:168714698-168714720 GATGAAGATGATGATGAGGATGG + Intergenic
1019223790 6:170494884-170494906 GGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019223808 6:170494964-170494986 GGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019223867 6:170495242-170495264 GGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019224190 6:170496706-170496728 GGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019224208 6:170496786-170496808 GGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019239325 6:170651487-170651509 GAACAAAAGAAGGAAGAAGAGGG - Intergenic
1019290458 7:247673-247695 TATGAAAAGAAAGACGGGGAGGG + Intronic
1019326957 7:443223-443245 GATGGACAGATGGATGAGAATGG + Intergenic
1019510640 7:1415772-1415794 GATGGATAGATGGATGGGGATGG + Intergenic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019931533 7:4226457-4226479 GGTGTAAGGAAGGATGGGGATGG - Intronic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020444505 7:8255200-8255222 TGTGAAGAGAAGGAAGAGGATGG - Intronic
1021116115 7:16748099-16748121 GAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1021176958 7:17460430-17460452 GATGAAACTAAGGTTCAGGATGG - Intergenic
1021352053 7:19605874-19605896 AATGAAAAGAAGGAGGGGAAAGG - Intergenic
1021407923 7:20295328-20295350 GAGGAAGAGGAGGGTGAGGAGGG - Intergenic
1021410156 7:20320933-20320955 GATGAGAAGAAGAATGAAGTAGG + Intergenic
1021537381 7:21721202-21721224 AAAGAAAAGAAGGAAGAGCAGGG - Intronic
1021849754 7:24795874-24795896 GCTGAGGAGAAGGAAGAGGAGGG - Intergenic
1022216060 7:28262784-28262806 GAAGGAAAGAAGGAGGAGGGAGG - Intergenic
1022306709 7:29153454-29153476 GAGGAGAAGAAGGAAGAAGAGGG - Intronic
1022311443 7:29200334-29200356 GAAGAAAAGAGGGAGGGGGAGGG - Intronic
1022435835 7:30384121-30384143 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1022511948 7:30941481-30941503 AAAGAAAAGAAGGCAGAGGAGGG - Intronic
1022596287 7:31716249-31716271 AATGAAAATAAGGCTGTGGAAGG - Intergenic
1022627177 7:32049474-32049496 GAATAAAAGAGGGATGAGGAAGG + Intronic
1022665902 7:32410346-32410368 GAGGAAAAGGAGGGTGAGGGCGG + Intergenic
1022684012 7:32577793-32577815 ATTGAAAAGAAGGCTGAAGAAGG + Intronic
1022816882 7:33922569-33922591 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1022856811 7:34323002-34323024 GATGAAAAGGATGATGCAGATGG - Intergenic
1022956730 7:35387859-35387881 GATGAATAAATGAATGAGGAAGG - Intergenic
1023105934 7:36763376-36763398 GATGAAAGGACAGATCAGGAAGG - Intergenic
1023207692 7:37768736-37768758 AATGAAAAGAAGTAGGAAGAAGG + Intronic
1023218418 7:37891699-37891721 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1023220818 7:37918969-37918991 TGTGAGAAGAAGGATTAGGATGG - Intronic
1023300111 7:38761172-38761194 GAAGAAAGGAAGGACAAGGAAGG - Intronic
1023409972 7:39880506-39880528 CATTAAAGGAAGGAAGAGGAGGG - Intergenic
1023706376 7:42945948-42945970 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1023740552 7:43277448-43277470 GCAGATAAGAGGGATGAGGAAGG + Intronic
1023907463 7:44532545-44532567 GAGGAAGAGGAGGAAGAGGAGGG - Intronic
1024109783 7:46133618-46133640 GAGGGAGAGAAGGAGGAGGAGGG - Intergenic
1024355442 7:48409776-48409798 CATCCAAAGAAGAATGAGGAGGG + Intronic
1024736782 7:52313677-52313699 AAAGAAAAGAAGGAGAAGGAAGG - Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1024924390 7:54598035-54598057 GCGGAAAAAATGGATGAGGAAGG - Intergenic
1025096669 7:56100998-56101020 GTGGAAAAGAGCGATGAGGAAGG - Intergenic
1025770600 7:64501664-64501686 GATGAAAAAGAGGCTGAGGAAGG + Intergenic
1025992874 7:66508829-66508851 AATGAAAAGGAGGAAAAGGAAGG - Intergenic
1026107182 7:67430492-67430514 GAGGAAGAGGAGGAAGAGGAAGG - Intergenic
1026159053 7:67852801-67852823 CAGGAAAAGAAGGAAGAAGAGGG + Intergenic
1026159090 7:67852942-67852964 GAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1026191879 7:68136335-68136357 GAAGAAGAGGAGGAGGAGGAAGG + Intergenic
1026191905 7:68136490-68136512 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1026205596 7:68254912-68254934 GAAGAATAGAAGGAGGAGGAAGG - Intergenic
1026205638 7:68255155-68255177 GAAGAATAGAAGGAGGAGGAAGG - Intergenic
1026205696 7:68255462-68255484 GAAGAATAGAAGGAGGAGGAAGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026245377 7:68615082-68615104 GAGGAGAAGAAGGAGGAGAAGGG + Intergenic
1026253489 7:68691031-68691053 GAAGGAAGGAAGGAAGAGGAGGG + Intergenic
1026872182 7:73859698-73859720 GATAAAAAGAGGGAAGGGGAGGG - Intergenic
1027199618 7:76055234-76055256 TTTGAAAAGTAGTATGAGGATGG + Intronic
1027234202 7:76288111-76288133 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027794757 7:82678687-82678709 GAGGAAAAAAATGCTGAGGATGG - Intergenic
1027952168 7:84830797-84830819 GATGAAGAGATGGTTGAGGGCGG - Intergenic
1028042578 7:86073504-86073526 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1028442070 7:90874822-90874844 CATTAAAAAAAGGATGAGGCCGG - Intronic
1028845377 7:95473907-95473929 GATGGAAAGAAGGAACCGGATGG + Intergenic
1029013641 7:97290558-97290580 GAAGAAAAGGAGGAAGAAGAAGG + Intergenic
1029367285 7:100124808-100124830 GAGGAAGAGGAGGAAGAGGAAGG + Exonic
1029474794 7:100776659-100776681 GAAGAAAGGAAGGAAGGGGAGGG - Intronic
1029575606 7:101401489-101401511 GACTAGAAGAAGGAAGAGGAGGG + Intronic
1029630473 7:101747228-101747250 GCGGAAAAGAGGGATGAGGAAGG - Intergenic
1029641868 7:101826142-101826164 GATGTACAGAGGGAGGAGGAGGG - Intronic
1029975025 7:104825798-104825820 GACAAAAAGAAGGAAGAAGAGGG + Intronic
1029995135 7:105000530-105000552 GATGGAAAAAAGGAGGAGGATGG + Intergenic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030134875 7:106236987-106237009 GATGAAAAAATGGATGAGTACGG - Intergenic
1030583992 7:111393815-111393837 AATCAAAAGAAGGATTTGGAGGG - Intronic
1030951664 7:115798242-115798264 CCTGAAAAGATGGAAGAGGAAGG + Intergenic
1031097513 7:117438537-117438559 AAGGAAAAGAAGGTTGAGAATGG + Intergenic
1031106499 7:117549824-117549846 GAAGAAAGGAAGTAGGAGGAAGG + Intronic
1031205848 7:118756684-118756706 GCTGCATAGAAGGCTGAGGAAGG + Intergenic
1031222183 7:118982186-118982208 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1031459909 7:122036137-122036159 GATGAACAGGAGGCTGATGAAGG - Intronic
1031649053 7:124263274-124263296 GATGAACAGCAGGAGGAGGCTGG + Intergenic
1032278903 7:130485617-130485639 GATGAAAAGGATGGGGAGGAGGG + Intergenic
1032381719 7:131491235-131491257 TAAGAAAAGAAGGGTTAGGAAGG - Exonic
1032439768 7:131933426-131933448 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1032523515 7:132562972-132562994 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1032523545 7:132563110-132563132 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1032523564 7:132563183-132563205 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1032769818 7:135039961-135039983 GAGGAAGAGAACGAGGAGGAGGG + Intronic
1032948716 7:136882440-136882462 GCTGAGAAGAAGGAGGGGGAAGG - Intronic
1033124796 7:138698158-138698180 GAGGGAAAGAAGGAGGGGGAAGG + Intronic
1033185506 7:139224417-139224439 GATGAAGAGAAGGACAGGGAGGG + Intergenic
1033256577 7:139806742-139806764 GATGAGAGGGAGGATGGGGAGGG - Intronic
1033354891 7:140591833-140591855 GAAGGAAAGAAGGAAGGGGAGGG - Intronic
1033361989 7:140644423-140644445 GAGGAAAAGGAGGGAGAGGAAGG - Intronic
1033651523 7:143347078-143347100 GATGGAAATAAGGATGATTATGG + Intronic
1033683407 7:143618720-143618742 GGGGAAAAGAGGGATGAGGAAGG + Intergenic
1033701206 7:143838918-143838940 GGGGAAAAGAGGGATGAGGAAGG - Intergenic
1033832601 7:145271573-145271595 GAAGAAAAGAAGGAAGAAGGAGG + Intergenic
1033832613 7:145271640-145271662 GAAGAAAAGAAGGGTGAAGAAGG + Intergenic
1033839422 7:145356260-145356282 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1033959413 7:146895258-146895280 GAAGGAAAGAAGGAAGGGGAAGG - Intronic
1033977427 7:147119026-147119048 GAGGAAAAGAAGGAAGAGCAGGG + Intronic
1034570458 7:151951588-151951610 GAGGCAAAGAAGTCTGAGGATGG + Intergenic
1034821898 7:154223671-154223693 GATGAGAGGAAGGAAGAGGTGGG + Intronic
1034823580 7:154239400-154239422 GATGAGGAGGAGGAAGAGGAAGG - Intronic
1034849396 7:154479903-154479925 GCTGAGAAGGAGGATGGGGAGGG - Intronic
1034921869 7:155089776-155089798 TGAGAAAAAAAGGATGAGGAGGG + Intergenic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1035419718 7:158717432-158717454 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419745 7:158717571-158717593 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035489709 7:159263156-159263178 GATGAAGAGAAAGAGGAAGAGGG + Intergenic
1035508445 8:155121-155143 GAACAAAAGAAGGAAGAAGAGGG + Intergenic
1035659674 8:1337563-1337585 GATGAAGAGGAGGAGGAAGATGG + Intergenic
1035979822 8:4357765-4357787 AATGAAAAGAATAAGGAGGATGG + Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1036704009 8:11032995-11033017 GATGAAAACGATGATCAGGATGG + Intronic
1037169488 8:15874130-15874152 GAGGAAAGGAAGGAAAAGGAAGG - Intergenic
1037201619 8:16260613-16260635 GATGATAATGAGGATGATGATGG + Intronic
1037218182 8:16483870-16483892 GAGGAAGAGGAGGAGGAGGATGG + Intronic
1037218195 8:16483930-16483952 GAGGAAGAGGAGGAGGAGGATGG + Intronic
1037227391 8:16609539-16609561 AAGGAACAGAAGGAAGAGGAGGG + Intergenic
1037300263 8:17444063-17444085 GATCAGAAGGAGGAGGAGGAGGG - Intergenic
1037307262 8:17518510-17518532 GATGAACACTAGGCTGAGGAAGG - Intronic
1037432097 8:18824420-18824442 GAGGAAACTAAGGATGAGAAAGG - Intronic
1037598440 8:20373767-20373789 GAGGAAGAAAAGGAGGAGGAGGG + Intergenic
1037598466 8:20373866-20373888 GAAGAGAAGGAGGAGGAGGAGGG + Intergenic
1037667451 8:20982364-20982386 GATGCAAAGAAAGATGAGATGGG - Intergenic
1037714019 8:21381743-21381765 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1037977519 8:23224328-23224350 GAAGAAAAGAAGGACGGGGGTGG + Intronic
1038045482 8:23762263-23762285 GATGAAAAGGAGGAGAAGGAAGG - Intergenic
1038048335 8:23786326-23786348 GATTAAAAAAAAGATGAAGAAGG + Intergenic
1038051734 8:23820434-23820456 GACAAACAGAAGGAAGAGGATGG - Intergenic
1038339542 8:26673923-26673945 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1038351410 8:26779534-26779556 CATGACAAGCAGGATGATGAAGG + Intronic
1038388924 8:27176426-27176448 GAAGAAAAGAAGGAAGTGGGAGG - Intergenic
1038534113 8:28341866-28341888 GATGAAAACAAGGTTGAAGCCGG - Intronic
1038626425 8:29197676-29197698 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1038679332 8:29652425-29652447 GAGGAAGAGAAGAAAGAGGAAGG + Intergenic
1038842276 8:31196023-31196045 GAGGAAAATAAGGCTTAGGAAGG + Intergenic
1038882201 8:31627561-31627583 GAGAAAAAGAAGGAGGGGGAGGG - Intergenic
1039329622 8:36522981-36523003 GATGAAAAGAATGCTGAGAAGGG - Intergenic
1039399003 8:37252726-37252748 GCACAAGAGAAGGATGAGGAAGG + Intergenic
1039435988 8:37559566-37559588 GAGGAAAAGAAGGAGGGGGAGGG + Intergenic
1039600530 8:38833243-38833265 GCGGAAAAGAGGGATGAGGAAGG + Intronic
1039814702 8:41082809-41082831 GAGGAAAAGGAGGTTGAGCAGGG + Intergenic
1039822762 8:41148189-41148211 GAAGAAGAGAGGGAGGAGGAGGG + Intergenic
1039884400 8:41646960-41646982 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1039926922 8:41942839-41942861 GAAGAAGAGGAGGCTGAGGAAGG - Exonic
1039931984 8:42001015-42001037 GAGGGAAGGAAGGAGGAGGAAGG + Intronic
1041199066 8:55432732-55432754 AATGAAAATAAGGTTCAGGAAGG - Intronic
1041201537 8:55454830-55454852 GAGGAAGAGGAGGATGAGGGAGG - Intronic
1041391916 8:57354530-57354552 GATGGAAAGAAAGATCAGGCCGG + Intergenic
1041669087 8:60475277-60475299 GAGGAAGAGGTGGATGAGGAAGG - Intergenic
1041860802 8:62510606-62510628 GAGGAAGAGGAGGAAGAGGAAGG + Intronic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042395661 8:68289136-68289158 GATCAGAACAAGGTTGAGGAGGG - Intergenic
1042421064 8:68589875-68589897 GAGGAAAGGAAGGAAGAAGAAGG + Intronic
1042480338 8:69295554-69295576 GATGAAAACCAGTATTAGGATGG - Intergenic
1042632927 8:70840588-70840610 CATAAAAAGAAGTCTGAGGATGG - Intergenic
1042660665 8:71150708-71150730 GATGATAATAATGATGATGATGG - Intergenic
1042708763 8:71691494-71691516 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1042732233 8:71948781-71948803 AATGAAAAGAAGGAAGGGGGAGG + Intronic
1042889320 8:73589885-73589907 GATGAGGATGAGGATGAGGAAGG + Intronic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043044346 8:75302175-75302197 TATGAAAAGTAGGCTGGGGAAGG - Intergenic
1043192025 8:77237596-77237618 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1043193481 8:77257920-77257942 GATGGAAACACGGATTAGGAAGG - Intergenic
1043215924 8:77587897-77587919 GATGAAGAGTAGGATGATGGAGG - Intergenic
1043379557 8:79687996-79688018 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1043386432 8:79752561-79752583 GAGGAAAAGGAGGAGGAAGAAGG + Intergenic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044286460 8:90416297-90416319 GAGGAAAAGAATTTTGAGGATGG - Intergenic
1044642703 8:94401333-94401355 GAGGAAGAGGAGGAAGAGGAAGG - Intronic
1044822974 8:96170125-96170147 AATGAAAAGAGGGAGGAAGATGG - Intergenic
1045016254 8:98003908-98003930 GATGAAACTGAGGATAAGGAAGG - Intronic
1045218507 8:100173826-100173848 GCTGAAAAGAATGATGAATAAGG + Intronic
1045398979 8:101792355-101792377 GATGAAAAGGAGGATGGAGTAGG - Intronic
1045868948 8:106903555-106903577 GACGAAAAGAAGAAGGAAGAAGG - Intergenic
1045975832 8:108129720-108129742 GAAGGAAAGAAGAAAGAGGAAGG + Intergenic
1046145959 8:110158654-110158676 GAAGGAAGGAAGGAAGAGGAGGG - Intergenic
1046537396 8:115532849-115532871 GATGATAAGAAGGCAGAGAAGGG + Intronic
1046625464 8:116572311-116572333 GATGAAGAGAAGAAGGGGGAGGG - Intergenic
1046751226 8:117929029-117929051 GAAGAAACTAAGGATGAGAAAGG - Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046846171 8:118919135-118919157 CAAGAAAATAAGGATGGGGAGGG + Intergenic
1047062444 8:121242880-121242902 GAAGAAGAGAATGAGGAGGAAGG - Intergenic
1047190063 8:122670387-122670409 AAGGAAAAGAAGCAAGAGGAAGG + Intergenic
1047299860 8:123604415-123604437 GAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1047306941 8:123660012-123660034 GATGAATGGATGGATGATGATGG - Intergenic
1048031123 8:130633446-130633468 GAGGAGAAGAAGGAAGGGGAGGG - Intergenic
1048032570 8:130646458-130646480 GAGGAAATGAGGCATGAGGAAGG - Intergenic
1048054129 8:130847191-130847213 GATGAAAAAGAGGCAGAGGAGGG + Intronic
1048073030 8:131040936-131040958 GGGGCAAAGAAGGAGGAGGAGGG + Exonic
1048175369 8:132147630-132147652 GATGAATGGATGGATGAAGATGG + Intronic
1048259877 8:132936549-132936571 AATGAAAAGATGAATGAGAAAGG - Intronic
1048262796 8:132959920-132959942 GCAGAAAAGAGTGATGAGGAAGG + Intronic
1049811298 8:144574182-144574204 GATGAGGAGGAGGAGGAGGAGGG + Intronic
1049893938 9:96527-96549 GCTATAAAGAAGGATGAGCAGGG + Intergenic
1050094169 9:2047060-2047082 GAGGGCAAGAAGGAAGAGGAGGG - Intronic
1050112535 9:2231696-2231718 CATGAACAGAAGGAGGAGGAAGG + Intergenic
1050224272 9:3433295-3433317 GATGAGAAGGAGGAAGAGTAGGG - Intronic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050475942 9:6041107-6041129 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1050846207 9:10223221-10223243 TAAGAAAAGGAGGAAGAGGAAGG - Intronic
1050869547 9:10549939-10549961 GCTTAAAGGAAAGATGAGGATGG - Intronic
1050969089 9:11846329-11846351 GAGGGAAAGAAAGATGGGGAAGG - Intergenic
1051078340 9:13266834-13266856 GAGAAAGAGAAGGAGGAGGAAGG + Intronic
1051218414 9:14823113-14823135 GATGAAAAGGAGGAAAAGAAAGG - Intronic
1051318093 9:15865506-15865528 GAGGAGGAGAAGGAAGAGGAGGG - Intronic
1051370962 9:16358684-16358706 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051873417 9:21765459-21765481 GAAGAAGAAAAGGAAGAGGAAGG + Intergenic
1052442040 9:28510499-28510521 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1052531180 9:29686289-29686311 AAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053550649 9:39076046-39076068 GATGAAAAGGAGTCTGTGGAAGG - Intronic
1053618630 9:39794323-39794345 GATGAAGAGAAGGGCAAGGAGGG - Intergenic
1053735166 9:41096611-41096633 GTTATAAAGAAGGATGAGCAGGG + Intergenic
1053814758 9:41896145-41896167 GATGAAAAGGAGTCTGTGGAAGG - Intronic
1053876805 9:42553685-42553707 GATGAAGAGAAGGGCAAGGAGGG - Intergenic
1053945439 9:43304500-43304522 GATGAAAAGAATTATGGAGATGG - Intergenic
1054234892 9:62548037-62548059 GATGAAGAGAAGGGCAAGGAGGG + Intergenic
1054265525 9:62913106-62913128 GATGAAGAGAAGGGCAAGGAGGG + Intergenic
1054615838 9:67291296-67291318 GATGAAAAGGAGTCTGTGGAAGG + Intergenic
1054693215 9:68334786-68334808 GCTATAAAGAAGGATGAGCAGGG - Intronic
1054804869 9:69388018-69388040 GATGAAAAGCAGGATGTGCATGG + Intronic
1054860763 9:69950549-69950571 GATGAAAAGAATAATGGAGATGG - Intergenic
1054932607 9:70651804-70651826 GAAGAAGAGAAGGATGAGTTAGG + Intronic
1054936254 9:70691930-70691952 GAGGAAAAGAGGGATGAGGAAGG - Intronic
1054959049 9:70946701-70946723 ACTGGAAAGGAGGATGAGGAGGG - Intronic
1055042545 9:71890923-71890945 GATGAAAAGAAGTACTAGGTAGG - Intronic
1055078876 9:72246941-72246963 GCAGAAAAGAGGGATGAGGGAGG - Intronic
1055188788 9:73492065-73492087 GAGGAAGAGGAGGAAGAGGAGGG + Intergenic
1055205478 9:73724182-73724204 GCTGAGAAGGAGGAAGAGGAGGG - Intergenic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055426358 9:76200850-76200872 GATGACAAGAGGGTGGAGGAAGG - Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055720599 9:79169071-79169093 GAGGAAAGGAAGGAGGAAGAGGG - Intergenic
1055728407 9:79256634-79256656 GATTCAAAGAAGGAAGAAGAAGG + Intergenic
1055901712 9:81246483-81246505 GAAAAAAAGAAGGATAAAGAAGG - Intergenic
1056063154 9:82906021-82906043 GATGATAAAAATGATAAGGAGGG - Intergenic
1056236970 9:84604361-84604383 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
1056388306 9:86117448-86117470 GGGGTAAAGAAGGAAGAGGAGGG + Intergenic
1056433654 9:86554111-86554133 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1056701759 9:88917120-88917142 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1056748035 9:89321742-89321764 CAAGAAAACAAGGATAAGGAAGG + Intronic
1057188029 9:93069383-93069405 AGTGAAAACAAGGATAAGGACGG + Intronic
1057396046 9:94681449-94681471 GATGAGAAGGAGGAGGAGGATGG - Intergenic
1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG + Exonic
1057673471 9:97117343-97117365 GATGAAAAGAGTTGTGAGGATGG - Intergenic
1057775471 9:98005132-98005154 GATGAAGAGGAGGAGGACGAAGG + Exonic
1057791849 9:98129896-98129918 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1057896456 9:98912781-98912803 GAGGAGAAGAAGGTAGAGGAGGG + Intergenic
1057945040 9:99319116-99319138 GGTGAAAAGAAGGAGGGAGAAGG - Intergenic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1058324654 9:103680321-103680343 GAAGGAAAGAAGGAAAAGGAAGG + Intergenic
1058556395 9:106173276-106173298 TAAGAAAATAAGGATGAGGGAGG - Intergenic
1058557003 9:106179932-106179954 GAGGAAAAAAAGGAGGATGAGGG - Intergenic
1058560134 9:106219383-106219405 GCAGAAAGGAAGGAGGAGGAAGG - Intergenic
1058625696 9:106930851-106930873 CCTGAACAGAAAGATGAGGAAGG - Intronic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058717523 9:107736340-107736362 GATGAGACCAAGGATGAGGGTGG - Intergenic
1058966848 9:110047085-110047107 AAAGAAAAGAAGGAAAAGGAAGG + Intronic
1059165960 9:112076726-112076748 GAAGAAAAGGAGGCTGAAGAGGG + Intronic
1059354234 9:113687092-113687114 GAGGAAAGGAGGGAGGAGGAGGG + Intergenic
1059411290 9:114133906-114133928 GATGATAAGAATGGTGATGAAGG + Intergenic
1059509546 9:114831353-114831375 GATGAAAAGGAGGATGAGACGGG - Intergenic
1059648157 9:116287687-116287709 GAAGAAAAGAAGGCTCAGGGAGG - Intronic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1059897882 9:118888607-118888629 GATGGATAGATGGATGAAGATGG - Intergenic
1059898797 9:118899018-118899040 GAGGAAGAGAAGGAAGAGAAGGG + Intergenic
1059931088 9:119261872-119261894 GAGGAAGAGAAGAAGGAGGAGGG - Intronic
1059932642 9:119276337-119276359 TATGAAAAGAAAAATCAGGAAGG - Intronic
1059940831 9:119358162-119358184 AATGAGAATAAGGATGAAGAGGG + Intronic
1060046031 9:120341819-120341841 GCTCAGAAGAAGGAGGAGGAGGG + Intergenic
1060278585 9:122200507-122200529 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1060608515 9:124940233-124940255 GAAGAAGTGAAGGAAGAGGAGGG + Intronic
1060661179 9:125406069-125406091 GAGGAAAAGAAGGCTCAGAAAGG + Intergenic
1061244807 9:129396026-129396048 GATGGAAAGACAGATGGGGATGG + Intergenic
1061658576 9:132112019-132112041 GATGAAGGGAGGGATGAGGAAGG + Intergenic
1061662479 9:132139323-132139345 GAAGAAGAGAAGGAAGAGAAGGG + Intergenic
1061721558 9:132554984-132555006 GATGGACAGATGGCTGAGGATGG - Intronic
1061968202 9:134028106-134028128 GATAAAAATAAGTGTGAGGAAGG - Intergenic
1062163925 9:135096201-135096223 GAGGAAGAGGAGGATGAAGAGGG - Intronic
1062176728 9:135167560-135167582 GATGACAGGAAGAATGAAGAAGG + Intergenic
1062513257 9:136919654-136919676 GAGGGAAAGAAGGAGGGGGAGGG - Intronic
1062665376 9:137668300-137668322 GGTGAATAGAAGGGAGAGGAAGG - Intronic
1062759533 9:138331778-138331800 GAACAAAAGAAGGAAGAAGAGGG - Intergenic
1203588574 Un_KI270747v1:33078-33100 GATGAAAAGAATTATGGAGATGG - Intergenic
1203599980 Un_KI270748v1:2550-2572 GAACAAAAGAAGGAAGAAGAGGG - Intergenic
1185499197 X:584537-584559 GAGGAAGAGAAAGAGGAGGAGGG + Intergenic
1185499209 X:584582-584604 GAGGAAGAGAAAGAGGAGGAGGG + Intergenic
1185499269 X:584836-584858 GAGGAAGAGAAAGAGGAGGAGGG + Intergenic
1185499280 X:584887-584909 GAGGAAGAGAAAGAGGAGGAGGG + Intergenic
1185499346 X:585140-585162 GAGGAGAAGAAGGTGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185540500 X:899418-899440 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1185623214 X:1465950-1465972 GAGGAACAGCAGGATGAAGATGG + Exonic
1185820619 X:3199732-3199754 GAGGAAGAGGAGGAAGAGGAAGG - Intergenic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186072924 X:5842236-5842258 GAGGAAAAGAAGGAAAAAGAGGG + Intronic
1186122802 X:6381861-6381883 GATGAAGAGTAGGATGAGGTGGG - Intergenic
1186268014 X:7852497-7852519 GAAGAAAAGAGGGATGAGAAGGG + Intergenic
1186645476 X:11502600-11502622 GAGGAAAAGGAGGTCGAGGAGGG - Intronic
1186788036 X:12971588-12971610 GAAGAGAAGAAGGAAGAGGAGGG - Intergenic
1186788389 X:12974328-12974350 TATGAAAATAAGGAAGAGGAAGG + Intergenic
1186795141 X:13039833-13039855 GATGAGCAGAAAGATGAGGAAGG - Exonic
1186938915 X:14482766-14482788 GATGACAACAAAGATGATGATGG - Intergenic
1187132227 X:16514108-16514130 GAAGAAAGGAAGGAGAAGGAGGG + Intergenic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187423848 X:19160053-19160075 GATGAATAAAAGGCAGAGGAGGG + Intergenic
1187480188 X:19648282-19648304 GAAGGAAAGAAGGAGAAGGAGGG + Intronic
1187492053 X:19761183-19761205 GAAGAAAACAAGGAGGAGGGAGG + Intronic
1187789797 X:22937773-22937795 GATGACTTGAAGGATGAGGATGG - Intergenic
1188257539 X:27981003-27981025 GAAGAAGAGATGGAGGAGGAAGG - Exonic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189112208 X:38303093-38303115 GTTGAAAAGAAGGAGGAAGAAGG - Intronic
1189141962 X:38616532-38616554 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1189426376 X:40905158-40905180 GATGAAAAGAATTATGGAGATGG + Intergenic
1189567868 X:42261984-42262006 ACTGAAAAGAAGAATGAGTATGG - Intergenic
1189585857 X:42461075-42461097 AATGAAAACTGGGATGAGGAAGG + Intergenic
1189695988 X:43663151-43663173 GAAGAAAAAAACGTTGAGGAGGG - Intronic
1189783765 X:44541706-44541728 AATCAAAAGAAGGATGAGGAGGG + Intronic
1190101600 X:47526396-47526418 GAAGGAAGGAAGGAAGAGGAAGG - Intergenic
1190123389 X:47682579-47682601 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1190706814 X:53035688-53035710 AATAAAAAGAAGGAAGAGGAGGG + Intergenic
1190716843 X:53111745-53111767 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1191862931 X:65680700-65680722 GATGAAAAAAAGAAAAAGGACGG - Intronic
1191980218 X:66917122-66917144 GATGAAAGGAAGGAGTTGGAGGG - Intergenic
1192007469 X:67232661-67232683 GAAGAGGAGAAGGAGGAGGATGG - Intergenic
1192185164 X:68941747-68941769 GAAGAAGAGAAGGAGGAGAAAGG + Intergenic
1192185177 X:68941818-68941840 GAAGAAGAGAAGGAGGAGAAAGG + Intergenic
1192190358 X:68987683-68987705 GAAGGAAACAAGGATGAGTATGG + Intergenic
1192244206 X:69359550-69359572 GATGAAGACAAGGATGCAGAAGG - Intergenic
1193247103 X:79242205-79242227 GAAGAAAAGAGGGAGGAAGAAGG - Intergenic
1193861017 X:86667342-86667364 GAAGGAAGGAAGGAAGAGGAAGG + Intronic
1193880521 X:86915365-86915387 GATGAAAAAGAGGCTAAGGAAGG + Intergenic
1194267368 X:91771465-91771487 GAAGAGGAGAAGGAGGAGGAGGG - Intergenic
1194270587 X:91809498-91809520 GATGAATGGATGGAAGAGGATGG + Intronic
1194756599 X:97745815-97745837 GATGAAAAGGAGGCTTTGGAGGG + Intergenic
1194921454 X:99771392-99771414 GAGGGAAGGAAGGAAGAGGAAGG + Intergenic
1195002645 X:100656906-100656928 GAAGAAAGGAAGGAGAAGGAAGG - Intronic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195480440 X:105338706-105338728 GAAGAAAAAAAGGATGAAAAAGG - Intronic
1195490266 X:105460448-105460470 GAAGGAAAGAAGGATGAGAGGGG - Intronic
1195850192 X:109274450-109274472 TCTGACAAGAACGATGAGGATGG - Intergenic
1195925363 X:110019281-110019303 GATGAAAAGGAGGAAGAGGGTGG - Intronic
1196174345 X:112624609-112624631 GATCCAAAAAAGGATGAGAAGGG + Intergenic
1196181102 X:112690491-112690513 GAGGAAGAGAAGAAGGAGGAGGG + Intergenic
1196190184 X:112786151-112786173 GATGAGAAGAAAGCAGAGGAAGG + Intronic
1196387435 X:115173796-115173818 GCTGAAGAGGAGGAAGAGGAGGG - Intronic
1196397508 X:115280878-115280900 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1196899204 X:120366657-120366679 GAGGAAAAGGAGGAGGAAGAGGG + Exonic
1197004340 X:121478479-121478501 TATGAAAAGAGGGATGACAATGG + Intergenic
1197457601 X:126697206-126697228 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1197779463 X:130145208-130145230 GAAAACAGGAAGGATGAGGAAGG + Intronic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1197859147 X:130950770-130950792 GGTGAGAAGCATGATGAGGAGGG + Intergenic
1197872104 X:131070372-131070394 GATGAGAAGGGGGATGAGGCAGG + Intronic
1198115138 X:133537402-133537424 GAGGGAAGGAAGGAAGAGGAAGG + Intronic
1198121457 X:133596538-133596560 GATAAAAACCTGGATGAGGAAGG - Exonic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198510996 X:137351715-137351737 GATGAATGGAAGGCTGAGGGGGG - Intergenic
1198651741 X:138870711-138870733 GATGAAAGGAAAGAAGAGGCAGG + Intronic
1198933207 X:141881131-141881153 GAAGAAGAGAAGGAAGAGGAGGG - Intronic
1199179907 X:144841586-144841608 GATGAACAAGAGGCTGAGGAAGG + Intergenic
1199280862 X:145997627-145997649 GGAGAAAAGAAGGATGTGGTGGG - Intergenic
1199349025 X:146777868-146777890 GACAAAAACAAGAATGAGGAAGG + Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1199842615 X:151665498-151665520 GATGGAGACCAGGATGAGGAAGG + Intronic
1200134794 X:153869722-153869744 GAGGAAGAGGAGGGTGAGGAAGG - Intronic
1200414778 Y:2898356-2898378 TGTGAAAAGAAGCTTGAGGATGG + Intronic
1200584573 Y:4992402-4992424 GAAGAGGAGAAGGAGGAGGAGGG - Intergenic
1200587820 Y:5030931-5030953 GATGAATGGATGGAAGAGGATGG + Intronic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201474565 Y:14366525-14366547 GATGAAAAGTGGGATTAGGTGGG + Intergenic
1201590384 Y:15608521-15608543 GAAGAAAGGAAAAATGAGGATGG + Intergenic
1201625595 Y:16011691-16011713 GAAGAAAAGAAACAGGAGGAAGG + Intergenic
1201735799 Y:17260211-17260233 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
1202142163 Y:21736311-21736333 TTTGAAAAGAAGGAAGAAGAGGG - Intergenic
1202144702 Y:21767491-21767513 TTTGAAAAGAAGGAAGAAGAGGG + Intergenic
1202274383 Y:23100275-23100297 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1202291644 Y:23320396-23320418 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1202427376 Y:24734026-24734048 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1202443415 Y:24936068-24936090 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic