ID: 1058275551

View in Genome Browser
Species Human (GRCh38)
Location 9:103037524-103037546
Sequence TGGGATACACACCCCCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058275546_1058275551 7 Left 1058275546 9:103037494-103037516 CCCAAGTGTGAGAAGGAGAGAGT No data
Right 1058275551 9:103037524-103037546 TGGGATACACACCCCCACCAGGG No data
1058275547_1058275551 6 Left 1058275547 9:103037495-103037517 CCAAGTGTGAGAAGGAGAGAGTT No data
Right 1058275551 9:103037524-103037546 TGGGATACACACCCCCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058275551 Original CRISPR TGGGATACACACCCCCACCA GGG Intergenic
No off target data available for this crispr