ID: 1058275715

View in Genome Browser
Species Human (GRCh38)
Location 9:103038568-103038590
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058275711_1058275715 -8 Left 1058275711 9:103038553-103038575 CCTGCACCACTCTGGCTAATTAG No data
Right 1058275715 9:103038568-103038590 CTAATTAGGAGGTCCTGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058275715 Original CRISPR CTAATTAGGAGGTCCTGAGC CGG Intergenic
No off target data available for this crispr