ID: 1058276632

View in Genome Browser
Species Human (GRCh38)
Location 9:103049915-103049937
Sequence TAGTGACTGCCAAATTTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058276632_1058276639 19 Left 1058276632 9:103049915-103049937 CCTAGTAAATTTGGCAGTCACTA No data
Right 1058276639 9:103049957-103049979 TCCCAGTTCTGGTCTGGGGAAGG No data
1058276632_1058276633 8 Left 1058276632 9:103049915-103049937 CCTAGTAAATTTGGCAGTCACTA No data
Right 1058276633 9:103049946-103049968 ATATCCCATATTCCCAGTTCTGG No data
1058276632_1058276637 14 Left 1058276632 9:103049915-103049937 CCTAGTAAATTTGGCAGTCACTA No data
Right 1058276637 9:103049952-103049974 CATATTCCCAGTTCTGGTCTGGG No data
1058276632_1058276638 15 Left 1058276632 9:103049915-103049937 CCTAGTAAATTTGGCAGTCACTA No data
Right 1058276638 9:103049953-103049975 ATATTCCCAGTTCTGGTCTGGGG No data
1058276632_1058276642 29 Left 1058276632 9:103049915-103049937 CCTAGTAAATTTGGCAGTCACTA No data
Right 1058276642 9:103049967-103049989 GGTCTGGGGAAGGTCCATATTGG No data
1058276632_1058276636 13 Left 1058276632 9:103049915-103049937 CCTAGTAAATTTGGCAGTCACTA No data
Right 1058276636 9:103049951-103049973 CCATATTCCCAGTTCTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058276632 Original CRISPR TAGTGACTGCCAAATTTACT AGG (reversed) Intergenic
No off target data available for this crispr