ID: 1058276635

View in Genome Browser
Species Human (GRCh38)
Location 9:103049951-103049973
Sequence CCAGACCAGAACTGGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058276635_1058276642 -7 Left 1058276635 9:103049951-103049973 CCATATTCCCAGTTCTGGTCTGG No data
Right 1058276642 9:103049967-103049989 GGTCTGGGGAAGGTCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058276635 Original CRISPR CCAGACCAGAACTGGGAATA TGG (reversed) Intergenic
No off target data available for this crispr