ID: 1058276642

View in Genome Browser
Species Human (GRCh38)
Location 9:103049967-103049989
Sequence GGTCTGGGGAAGGTCCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058276632_1058276642 29 Left 1058276632 9:103049915-103049937 CCTAGTAAATTTGGCAGTCACTA No data
Right 1058276642 9:103049967-103049989 GGTCTGGGGAAGGTCCATATTGG No data
1058276634_1058276642 -6 Left 1058276634 9:103049950-103049972 CCCATATTCCCAGTTCTGGTCTG No data
Right 1058276642 9:103049967-103049989 GGTCTGGGGAAGGTCCATATTGG No data
1058276635_1058276642 -7 Left 1058276635 9:103049951-103049973 CCATATTCCCAGTTCTGGTCTGG No data
Right 1058276642 9:103049967-103049989 GGTCTGGGGAAGGTCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058276642 Original CRISPR GGTCTGGGGAAGGTCCATAT TGG Intergenic
No off target data available for this crispr