ID: 1058280166

View in Genome Browser
Species Human (GRCh38)
Location 9:103103811-103103833
Sequence ATGGAGAGAAGACCTGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058280166_1058280173 19 Left 1058280166 9:103103811-103103833 CCTACCTCAGGTCTTCTCTCCAT No data
Right 1058280173 9:103103853-103103875 GGGACAACCTGCCTGTGGAAAGG 0: 8
1: 40
2: 106
3: 260
4: 556
1058280166_1058280170 -2 Left 1058280166 9:103103811-103103833 CCTACCTCAGGTCTTCTCTCCAT No data
Right 1058280170 9:103103832-103103854 ATTGAGGACTGCAGACACGATGG No data
1058280166_1058280172 14 Left 1058280166 9:103103811-103103833 CCTACCTCAGGTCTTCTCTCCAT No data
Right 1058280172 9:103103848-103103870 ACGATGGGACAACCTGCCTGTGG No data
1058280166_1058280171 -1 Left 1058280166 9:103103811-103103833 CCTACCTCAGGTCTTCTCTCCAT No data
Right 1058280171 9:103103833-103103855 TTGAGGACTGCAGACACGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058280166 Original CRISPR ATGGAGAGAAGACCTGAGGT AGG (reversed) Intergenic
No off target data available for this crispr