ID: 1058284587

View in Genome Browser
Species Human (GRCh38)
Location 9:103160945-103160967
Sequence TGCAATCTCAAAAATGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058284587_1058284588 -1 Left 1058284587 9:103160945-103160967 CCATCATCATTTTTGAGATTGCA No data
Right 1058284588 9:103160967-103160989 ATTTACCCTGAAAAAATTATAGG No data
1058284587_1058284589 0 Left 1058284587 9:103160945-103160967 CCATCATCATTTTTGAGATTGCA No data
Right 1058284589 9:103160968-103160990 TTTACCCTGAAAAAATTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058284587 Original CRISPR TGCAATCTCAAAAATGATGA TGG (reversed) Intergenic
No off target data available for this crispr