ID: 1058285363

View in Genome Browser
Species Human (GRCh38)
Location 9:103170065-103170087
Sequence AGGGAGAGGGCAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058285363_1058285373 25 Left 1058285363 9:103170065-103170087 CCCACAGTCACTGCCCTCTCCCT No data
Right 1058285373 9:103170113-103170135 CATGACATGTGGCTGCTGCTGGG No data
1058285363_1058285370 14 Left 1058285363 9:103170065-103170087 CCCACAGTCACTGCCCTCTCCCT No data
Right 1058285370 9:103170102-103170124 GACTATTTCTCCATGACATGTGG No data
1058285363_1058285372 24 Left 1058285363 9:103170065-103170087 CCCACAGTCACTGCCCTCTCCCT No data
Right 1058285372 9:103170112-103170134 CCATGACATGTGGCTGCTGCTGG No data
1058285363_1058285374 26 Left 1058285363 9:103170065-103170087 CCCACAGTCACTGCCCTCTCCCT No data
Right 1058285374 9:103170114-103170136 ATGACATGTGGCTGCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058285363 Original CRISPR AGGGAGAGGGCAGTGACTGT GGG (reversed) Intergenic
No off target data available for this crispr