ID: 1058294508

View in Genome Browser
Species Human (GRCh38)
Location 9:103288600-103288622
Sequence GATCACAGCCTTGACATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058294508_1058294509 0 Left 1058294508 9:103288600-103288622 CCAGTGATGTCAAGGCTGTGATC No data
Right 1058294509 9:103288623-103288645 TGAATAGCAATGCAAGAATCAGG No data
1058294508_1058294511 29 Left 1058294508 9:103288600-103288622 CCAGTGATGTCAAGGCTGTGATC No data
Right 1058294511 9:103288652-103288674 GTATTAGAGATAATTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058294508 Original CRISPR GATCACAGCCTTGACATCAC TGG (reversed) Intergenic
No off target data available for this crispr