ID: 1058294509

View in Genome Browser
Species Human (GRCh38)
Location 9:103288623-103288645
Sequence TGAATAGCAATGCAAGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058294506_1058294509 8 Left 1058294506 9:103288592-103288614 CCAAGGTTCCAGTGATGTCAAGG No data
Right 1058294509 9:103288623-103288645 TGAATAGCAATGCAAGAATCAGG No data
1058294508_1058294509 0 Left 1058294508 9:103288600-103288622 CCAGTGATGTCAAGGCTGTGATC No data
Right 1058294509 9:103288623-103288645 TGAATAGCAATGCAAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058294509 Original CRISPR TGAATAGCAATGCAAGAATC AGG Intergenic
No off target data available for this crispr