ID: 1058302971

View in Genome Browser
Species Human (GRCh38)
Location 9:103398950-103398972
Sequence GCCAACAACTCAACTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058302958_1058302971 29 Left 1058302958 9:103398898-103398920 CCAGGAGCTCAAGCACCAGCCTG No data
Right 1058302971 9:103398950-103398972 GCCAACAACTCAACTGGGGTGGG No data
1058302964_1058302971 10 Left 1058302964 9:103398917-103398939 CCTGGATATGGAGGGACAAACTG No data
Right 1058302971 9:103398950-103398972 GCCAACAACTCAACTGGGGTGGG No data
1058302963_1058302971 14 Left 1058302963 9:103398913-103398935 CCAGCCTGGATATGGAGGGACAA No data
Right 1058302971 9:103398950-103398972 GCCAACAACTCAACTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058302971 Original CRISPR GCCAACAACTCAACTGGGGT GGG Intergenic
No off target data available for this crispr