ID: 1058308350

View in Genome Browser
Species Human (GRCh38)
Location 9:103471047-103471069
Sequence ACGGATACTAGCGCCTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058308345_1058308350 11 Left 1058308345 9:103471013-103471035 CCTGTGATGTGAACTGTCTATGG 0: 46
1: 99
2: 200
3: 218
4: 315
Right 1058308350 9:103471047-103471069 ACGGATACTAGCGCCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058308350 Original CRISPR ACGGATACTAGCGCCTGTGC AGG Intergenic
No off target data available for this crispr