ID: 1058312525

View in Genome Browser
Species Human (GRCh38)
Location 9:103522040-103522062
Sequence GCTTCTATTTACCTACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058312525_1058312529 15 Left 1058312525 9:103522040-103522062 CCAGTTTGTAGGTAAATAGAAGC No data
Right 1058312529 9:103522078-103522100 GCCTCAGCAAGCAAGTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058312525 Original CRISPR GCTTCTATTTACCTACAAAC TGG (reversed) Intergenic
No off target data available for this crispr