ID: 1058312744

View in Genome Browser
Species Human (GRCh38)
Location 9:103525751-103525773
Sequence ATGCTCTTTCAGAAGAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058312744_1058312748 1 Left 1058312744 9:103525751-103525773 CCATCACTCTTCTGAAAGAGCAT No data
Right 1058312748 9:103525775-103525797 CCAATCAATCTTTGGAATGGAGG No data
1058312744_1058312746 -2 Left 1058312744 9:103525751-103525773 CCATCACTCTTCTGAAAGAGCAT No data
Right 1058312746 9:103525772-103525794 ATTCCAATCAATCTTTGGAATGG No data
1058312744_1058312745 -7 Left 1058312744 9:103525751-103525773 CCATCACTCTTCTGAAAGAGCAT No data
Right 1058312745 9:103525767-103525789 AGAGCATTCCAATCAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058312744 Original CRISPR ATGCTCTTTCAGAAGAGTGA TGG (reversed) Intergenic
No off target data available for this crispr