ID: 1058321688

View in Genome Browser
Species Human (GRCh38)
Location 9:103639638-103639660
Sequence GTACTGTGGTTGGCTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058321683_1058321688 8 Left 1058321683 9:103639607-103639629 CCTCCACATGTTATTTGATTACA No data
Right 1058321688 9:103639638-103639660 GTACTGTGGTTGGCTCCTACAGG No data
1058321684_1058321688 5 Left 1058321684 9:103639610-103639632 CCACATGTTATTTGATTACATTT No data
Right 1058321688 9:103639638-103639660 GTACTGTGGTTGGCTCCTACAGG No data
1058321682_1058321688 16 Left 1058321682 9:103639599-103639621 CCAAACTTCCTCCACATGTTATT No data
Right 1058321688 9:103639638-103639660 GTACTGTGGTTGGCTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058321688 Original CRISPR GTACTGTGGTTGGCTCCTAC AGG Intergenic
No off target data available for this crispr