ID: 1058323833

View in Genome Browser
Species Human (GRCh38)
Location 9:103670192-103670214
Sequence TTCCCCAGCACTGCGTAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058323833_1058323840 8 Left 1058323833 9:103670192-103670214 CCTAGTTACGCAGTGCTGGGGAA No data
Right 1058323840 9:103670223-103670245 AGGGTCAAAGCAGTGAGGTTTGG No data
1058323833_1058323838 3 Left 1058323833 9:103670192-103670214 CCTAGTTACGCAGTGCTGGGGAA No data
Right 1058323838 9:103670218-103670240 GGACCAGGGTCAAAGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058323833 Original CRISPR TTCCCCAGCACTGCGTAACT AGG (reversed) Intergenic
No off target data available for this crispr