ID: 1058326038

View in Genome Browser
Species Human (GRCh38)
Location 9:103698917-103698939
Sequence TCATAAAGTACCCTTACTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058326035_1058326038 8 Left 1058326035 9:103698886-103698908 CCCCAAGGAAAGGTTTTTAAGTG No data
Right 1058326038 9:103698917-103698939 TCATAAAGTACCCTTACTCTCGG No data
1058326036_1058326038 7 Left 1058326036 9:103698887-103698909 CCCAAGGAAAGGTTTTTAAGTGA No data
Right 1058326038 9:103698917-103698939 TCATAAAGTACCCTTACTCTCGG No data
1058326032_1058326038 26 Left 1058326032 9:103698868-103698890 CCATGGACAGAATTTCATCCCCA No data
Right 1058326038 9:103698917-103698939 TCATAAAGTACCCTTACTCTCGG No data
1058326037_1058326038 6 Left 1058326037 9:103698888-103698910 CCAAGGAAAGGTTTTTAAGTGAG No data
Right 1058326038 9:103698917-103698939 TCATAAAGTACCCTTACTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058326038 Original CRISPR TCATAAAGTACCCTTACTCT CGG Intergenic
No off target data available for this crispr