ID: 1058327702

View in Genome Browser
Species Human (GRCh38)
Location 9:103718757-103718779
Sequence ATTTTTAAGGGGATCATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058327693_1058327702 5 Left 1058327693 9:103718729-103718751 CCATCTCCTCGAGGAGTTCTTGG No data
Right 1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG No data
1058327692_1058327702 6 Left 1058327692 9:103718728-103718750 CCCATCTCCTCGAGGAGTTCTTG No data
Right 1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG No data
1058327691_1058327702 13 Left 1058327691 9:103718721-103718743 CCTCAAACCCATCTCCTCGAGGA No data
Right 1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG No data
1058327697_1058327702 -1 Left 1058327697 9:103718735-103718757 CCTCGAGGAGTTCTTGGCTGGGA No data
Right 1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058327702 Original CRISPR ATTTTTAAGGGGATCATTGA GGG Intergenic
No off target data available for this crispr