ID: 1058334998

View in Genome Browser
Species Human (GRCh38)
Location 9:103815850-103815872
Sequence GACTCTATTGGAGAACAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058334998_1058335002 -7 Left 1058334998 9:103815850-103815872 CCTGGTTGTTCTCCAATAGAGTC No data
Right 1058335002 9:103815866-103815888 TAGAGTCTACATTAGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058334998 Original CRISPR GACTCTATTGGAGAACAACC AGG (reversed) Intergenic
No off target data available for this crispr