ID: 1058339599

View in Genome Browser
Species Human (GRCh38)
Location 9:103878224-103878246
Sequence AAGAATCAGAATTATTGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058339599_1058339603 8 Left 1058339599 9:103878224-103878246 CCCGGCCAATAATTCTGATTCTT No data
Right 1058339603 9:103878255-103878277 TAATATAATCACTTATTTGCAGG No data
1058339599_1058339604 13 Left 1058339599 9:103878224-103878246 CCCGGCCAATAATTCTGATTCTT No data
Right 1058339604 9:103878260-103878282 TAATCACTTATTTGCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058339599 Original CRISPR AAGAATCAGAATTATTGGCC GGG (reversed) Intergenic
No off target data available for this crispr