ID: 1058339603

View in Genome Browser
Species Human (GRCh38)
Location 9:103878255-103878277
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058339599_1058339603 8 Left 1058339599 9:103878224-103878246 CCCGGCCAATAATTCTGATTCTT No data
Right 1058339603 9:103878255-103878277 TAATATAATCACTTATTTGCAGG No data
1058339601_1058339603 3 Left 1058339601 9:103878229-103878251 CCAATAATTCTGATTCTTAGTCC No data
Right 1058339603 9:103878255-103878277 TAATATAATCACTTATTTGCAGG No data
1058339598_1058339603 13 Left 1058339598 9:103878219-103878241 CCGCGCCCGGCCAATAATTCTGA No data
Right 1058339603 9:103878255-103878277 TAATATAATCACTTATTTGCAGG No data
1058339597_1058339603 16 Left 1058339597 9:103878216-103878238 CCACCGCGCCCGGCCAATAATTC 0: 5
1: 72
2: 562
3: 3694
4: 19460
Right 1058339603 9:103878255-103878277 TAATATAATCACTTATTTGCAGG No data
1058339600_1058339603 7 Left 1058339600 9:103878225-103878247 CCGGCCAATAATTCTGATTCTTA No data
Right 1058339603 9:103878255-103878277 TAATATAATCACTTATTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058339603 Original CRISPR TAATATAATCACTTATTTGC AGG Intergenic
No off target data available for this crispr