ID: 1058342153

View in Genome Browser
Species Human (GRCh38)
Location 9:103911621-103911643
Sequence TGGGGTAAACTGATGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058342148_1058342153 6 Left 1058342148 9:103911592-103911614 CCTGTTCAGCAGGTGTCTAAAGT No data
Right 1058342153 9:103911621-103911643 TGGGGTAAACTGATGGATTCAGG No data
1058342146_1058342153 18 Left 1058342146 9:103911580-103911602 CCAGAAGTGTCACCTGTTCAGCA No data
Right 1058342153 9:103911621-103911643 TGGGGTAAACTGATGGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058342153 Original CRISPR TGGGGTAAACTGATGGATTC AGG Intergenic
No off target data available for this crispr