ID: 1058344608

View in Genome Browser
Species Human (GRCh38)
Location 9:103946370-103946392
Sequence CACTGCTCATATAAGAACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058344608_1058344611 25 Left 1058344608 9:103946370-103946392 CCTTAGTTCTTATATGAGCAGTG No data
Right 1058344611 9:103946418-103946440 CTGCTTTTTTATCAAAATATTGG No data
1058344608_1058344612 26 Left 1058344608 9:103946370-103946392 CCTTAGTTCTTATATGAGCAGTG No data
Right 1058344612 9:103946419-103946441 TGCTTTTTTATCAAAATATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058344608 Original CRISPR CACTGCTCATATAAGAACTA AGG (reversed) Intergenic
No off target data available for this crispr