ID: 1058351035

View in Genome Browser
Species Human (GRCh38)
Location 9:104024351-104024373
Sequence ATAAGGCTATTTCTCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058351029_1058351035 18 Left 1058351029 9:104024310-104024332 CCTCATTTTTATTCTATATGCCC No data
Right 1058351035 9:104024351-104024373 ATAAGGCTATTTCTCCATGTTGG No data
1058351032_1058351035 -3 Left 1058351032 9:104024331-104024353 CCCTATGTGGAATTGAGAAAATA No data
Right 1058351035 9:104024351-104024373 ATAAGGCTATTTCTCCATGTTGG No data
1058351033_1058351035 -4 Left 1058351033 9:104024332-104024354 CCTATGTGGAATTGAGAAAATAA No data
Right 1058351035 9:104024351-104024373 ATAAGGCTATTTCTCCATGTTGG No data
1058351031_1058351035 -2 Left 1058351031 9:104024330-104024352 CCCCTATGTGGAATTGAGAAAAT No data
Right 1058351035 9:104024351-104024373 ATAAGGCTATTTCTCCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058351035 Original CRISPR ATAAGGCTATTTCTCCATGT TGG Intergenic
No off target data available for this crispr