ID: 1058354424

View in Genome Browser
Species Human (GRCh38)
Location 9:104066071-104066093
Sequence GCTGAGGTGCAGAAGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058354424_1058354428 17 Left 1058354424 9:104066071-104066093 CCTTCATCCTTCTGCACCTCAGC No data
Right 1058354428 9:104066111-104066133 TCTCCTTCTCCAGTTATTAAGGG No data
1058354424_1058354432 30 Left 1058354424 9:104066071-104066093 CCTTCATCCTTCTGCACCTCAGC No data
Right 1058354432 9:104066124-104066146 TTATTAAGGGGCCAATCCAAAGG No data
1058354424_1058354429 18 Left 1058354424 9:104066071-104066093 CCTTCATCCTTCTGCACCTCAGC No data
Right 1058354429 9:104066112-104066134 CTCCTTCTCCAGTTATTAAGGGG No data
1058354424_1058354427 16 Left 1058354424 9:104066071-104066093 CCTTCATCCTTCTGCACCTCAGC No data
Right 1058354427 9:104066110-104066132 ATCTCCTTCTCCAGTTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058354424 Original CRISPR GCTGAGGTGCAGAAGGATGA AGG (reversed) Intergenic
No off target data available for this crispr