ID: 1058354427

View in Genome Browser
Species Human (GRCh38)
Location 9:104066110-104066132
Sequence ATCTCCTTCTCCAGTTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058354426_1058354427 0 Left 1058354426 9:104066087-104066109 CCTCAGCTCATTTTCAACTGCAA No data
Right 1058354427 9:104066110-104066132 ATCTCCTTCTCCAGTTATTAAGG No data
1058354424_1058354427 16 Left 1058354424 9:104066071-104066093 CCTTCATCCTTCTGCACCTCAGC No data
Right 1058354427 9:104066110-104066132 ATCTCCTTCTCCAGTTATTAAGG No data
1058354425_1058354427 9 Left 1058354425 9:104066078-104066100 CCTTCTGCACCTCAGCTCATTTT No data
Right 1058354427 9:104066110-104066132 ATCTCCTTCTCCAGTTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058354427 Original CRISPR ATCTCCTTCTCCAGTTATTA AGG Intergenic
No off target data available for this crispr