ID: 1058364196

View in Genome Browser
Species Human (GRCh38)
Location 9:104188396-104188418
Sequence AACTTCCACCTCCTACCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058364196_1058364203 19 Left 1058364196 9:104188396-104188418 CCACTGGGTAGGAGGTGGAAGTT No data
Right 1058364203 9:104188438-104188460 TCAGTGATACCATAGGGTGTTGG No data
1058364196_1058364200 12 Left 1058364196 9:104188396-104188418 CCACTGGGTAGGAGGTGGAAGTT No data
Right 1058364200 9:104188431-104188453 ATGGCCTTCAGTGATACCATAGG No data
1058364196_1058364205 21 Left 1058364196 9:104188396-104188418 CCACTGGGTAGGAGGTGGAAGTT No data
Right 1058364205 9:104188440-104188462 AGTGATACCATAGGGTGTTGGGG No data
1058364196_1058364198 -7 Left 1058364196 9:104188396-104188418 CCACTGGGTAGGAGGTGGAAGTT No data
Right 1058364198 9:104188412-104188434 GGAAGTTCAGGATCTCCACATGG No data
1058364196_1058364201 13 Left 1058364196 9:104188396-104188418 CCACTGGGTAGGAGGTGGAAGTT No data
Right 1058364201 9:104188432-104188454 TGGCCTTCAGTGATACCATAGGG No data
1058364196_1058364204 20 Left 1058364196 9:104188396-104188418 CCACTGGGTAGGAGGTGGAAGTT No data
Right 1058364204 9:104188439-104188461 CAGTGATACCATAGGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058364196 Original CRISPR AACTTCCACCTCCTACCCAG TGG (reversed) Intergenic
No off target data available for this crispr