ID: 1058364204

View in Genome Browser
Species Human (GRCh38)
Location 9:104188439-104188461
Sequence CAGTGATACCATAGGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058364196_1058364204 20 Left 1058364196 9:104188396-104188418 CCACTGGGTAGGAGGTGGAAGTT No data
Right 1058364204 9:104188439-104188461 CAGTGATACCATAGGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058364204 Original CRISPR CAGTGATACCATAGGGTGTT GGG Intergenic
No off target data available for this crispr