ID: 1058371793

View in Genome Browser
Species Human (GRCh38)
Location 9:104277364-104277386
Sequence GTGGATTTGCCTCCTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058371793_1058371795 -8 Left 1058371793 9:104277364-104277386 CCTCCTGCAGGAGGCAAATCCAC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1058371795 9:104277379-104277401 AAATCCACGAAAAACAGCATTGG 0: 1
1: 0
2: 3
3: 9
4: 166
1058371793_1058371797 13 Left 1058371793 9:104277364-104277386 CCTCCTGCAGGAGGCAAATCCAC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1058371797 9:104277400-104277422 GGAATCTTCAGAATATTTACTGG 0: 1
1: 0
2: 0
3: 12
4: 184
1058371793_1058371798 14 Left 1058371793 9:104277364-104277386 CCTCCTGCAGGAGGCAAATCCAC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1058371798 9:104277401-104277423 GAATCTTCAGAATATTTACTGGG 0: 1
1: 0
2: 2
3: 25
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058371793 Original CRISPR GTGGATTTGCCTCCTGCAGG AGG (reversed) Intergenic