ID: 1058377774

View in Genome Browser
Species Human (GRCh38)
Location 9:104343898-104343920
Sequence TGTAGTACCAGCAGCTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058377766_1058377774 27 Left 1058377766 9:104343848-104343870 CCTGTCTCTACTAAAATACAAAA 0: 4694
1: 7812
2: 9669
3: 28265
4: 238330
Right 1058377774 9:104343898-104343920 TGTAGTACCAGCAGCTCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058377774 Original CRISPR TGTAGTACCAGCAGCTCGGG AGG Intergenic
No off target data available for this crispr