ID: 1058377928

View in Genome Browser
Species Human (GRCh38)
Location 9:104345810-104345832
Sequence TGTTATGTAACATAAACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058377928_1058377930 22 Left 1058377928 9:104345810-104345832 CCATTTGTTTATGTTACATAACA No data
Right 1058377930 9:104345855-104345877 AGTGTTTTGTATGTCATTCTAGG No data
1058377928_1058377931 28 Left 1058377928 9:104345810-104345832 CCATTTGTTTATGTTACATAACA No data
Right 1058377931 9:104345861-104345883 TTGTATGTCATTCTAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058377928 Original CRISPR TGTTATGTAACATAAACAAA TGG (reversed) Intergenic
No off target data available for this crispr