ID: 1058378689

View in Genome Browser
Species Human (GRCh38)
Location 9:104354992-104355014
Sequence TTATTATACTTTAAGTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37723
Summary {0: 13628, 1: 11495, 2: 6190, 3: 3554, 4: 2856}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058378689_1058378692 28 Left 1058378689 9:104354992-104355014 CCCTAAAACTTAAAGTATAATAA 0: 13628
1: 11495
2: 6190
3: 3554
4: 2856
Right 1058378692 9:104355043-104355065 TCTCCTGCATTCCATCTCCAGGG No data
1058378689_1058378691 27 Left 1058378689 9:104354992-104355014 CCCTAAAACTTAAAGTATAATAA 0: 13628
1: 11495
2: 6190
3: 3554
4: 2856
Right 1058378691 9:104355042-104355064 TTCTCCTGCATTCCATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058378689 Original CRISPR TTATTATACTTTAAGTTTTA GGG (reversed) Intergenic
Too many off-targets to display for this crispr