ID: 1058378690

View in Genome Browser
Species Human (GRCh38)
Location 9:104354993-104355015
Sequence TTTATTATACTTTAAGTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46780
Summary {0: 4143, 1: 17745, 2: 12044, 3: 7139, 4: 5709}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058378690_1058378691 26 Left 1058378690 9:104354993-104355015 CCTAAAACTTAAAGTATAATAAA 0: 4143
1: 17745
2: 12044
3: 7139
4: 5709
Right 1058378691 9:104355042-104355064 TTCTCCTGCATTCCATCTCCAGG No data
1058378690_1058378692 27 Left 1058378690 9:104354993-104355015 CCTAAAACTTAAAGTATAATAAA 0: 4143
1: 17745
2: 12044
3: 7139
4: 5709
Right 1058378692 9:104355043-104355065 TCTCCTGCATTCCATCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058378690 Original CRISPR TTTATTATACTTTAAGTTTT AGG (reversed) Intergenic
Too many off-targets to display for this crispr