ID: 1058378691

View in Genome Browser
Species Human (GRCh38)
Location 9:104355042-104355064
Sequence TTCTCCTGCATTCCATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058378690_1058378691 26 Left 1058378690 9:104354993-104355015 CCTAAAACTTAAAGTATAATAAA 0: 4143
1: 17745
2: 12044
3: 7139
4: 5709
Right 1058378691 9:104355042-104355064 TTCTCCTGCATTCCATCTCCAGG No data
1058378689_1058378691 27 Left 1058378689 9:104354992-104355014 CCCTAAAACTTAAAGTATAATAA 0: 13628
1: 11495
2: 6190
3: 3554
4: 2856
Right 1058378691 9:104355042-104355064 TTCTCCTGCATTCCATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058378691 Original CRISPR TTCTCCTGCATTCCATCTCC AGG Intergenic
No off target data available for this crispr