ID: 1058379313

View in Genome Browser
Species Human (GRCh38)
Location 9:104361358-104361380
Sequence AGGCCAGTGCGAGATTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058379313_1058379324 27 Left 1058379313 9:104361358-104361380 CCTGGAGAATCTCGCACTGGCCT No data
Right 1058379324 9:104361408-104361430 CAGGAAGTTCCCGCCGTTTGCGG No data
1058379313_1058379325 30 Left 1058379313 9:104361358-104361380 CCTGGAGAATCTCGCACTGGCCT No data
Right 1058379325 9:104361411-104361433 GAAGTTCCCGCCGTTTGCGGAGG No data
1058379313_1058379322 8 Left 1058379313 9:104361358-104361380 CCTGGAGAATCTCGCACTGGCCT No data
Right 1058379322 9:104361389-104361411 GGAGAACAGGGTGGAGCCACAGG No data
1058379313_1058379321 -1 Left 1058379313 9:104361358-104361380 CCTGGAGAATCTCGCACTGGCCT No data
Right 1058379321 9:104361380-104361402 TGGGAACTGGGAGAACAGGGTGG No data
1058379313_1058379319 -4 Left 1058379313 9:104361358-104361380 CCTGGAGAATCTCGCACTGGCCT No data
Right 1058379319 9:104361377-104361399 GCCTGGGAACTGGGAGAACAGGG No data
1058379313_1058379318 -5 Left 1058379313 9:104361358-104361380 CCTGGAGAATCTCGCACTGGCCT No data
Right 1058379318 9:104361376-104361398 GGCCTGGGAACTGGGAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058379313 Original CRISPR AGGCCAGTGCGAGATTCTCC AGG (reversed) Intergenic
No off target data available for this crispr