ID: 1058379320

View in Genome Browser
Species Human (GRCh38)
Location 9:104361378-104361400
Sequence ACCCTGTTCTCCCAGTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058379320_1058379332 22 Left 1058379320 9:104361378-104361400 CCTGGGAACTGGGAGAACAGGGT No data
Right 1058379332 9:104361423-104361445 GTTTGCGGAGGGGAGGAGCCTGG No data
1058379320_1058379324 7 Left 1058379320 9:104361378-104361400 CCTGGGAACTGGGAGAACAGGGT No data
Right 1058379324 9:104361408-104361430 CAGGAAGTTCCCGCCGTTTGCGG No data
1058379320_1058379327 12 Left 1058379320 9:104361378-104361400 CCTGGGAACTGGGAGAACAGGGT No data
Right 1058379327 9:104361413-104361435 AGTTCCCGCCGTTTGCGGAGGGG No data
1058379320_1058379328 15 Left 1058379320 9:104361378-104361400 CCTGGGAACTGGGAGAACAGGGT No data
Right 1058379328 9:104361416-104361438 TCCCGCCGTTTGCGGAGGGGAGG No data
1058379320_1058379325 10 Left 1058379320 9:104361378-104361400 CCTGGGAACTGGGAGAACAGGGT No data
Right 1058379325 9:104361411-104361433 GAAGTTCCCGCCGTTTGCGGAGG No data
1058379320_1058379326 11 Left 1058379320 9:104361378-104361400 CCTGGGAACTGGGAGAACAGGGT No data
Right 1058379326 9:104361412-104361434 AAGTTCCCGCCGTTTGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058379320 Original CRISPR ACCCTGTTCTCCCAGTTCCC AGG (reversed) Intergenic
No off target data available for this crispr