ID: 1058379324

View in Genome Browser
Species Human (GRCh38)
Location 9:104361408-104361430
Sequence CAGGAAGTTCCCGCCGTTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058379313_1058379324 27 Left 1058379313 9:104361358-104361380 CCTGGAGAATCTCGCACTGGCCT No data
Right 1058379324 9:104361408-104361430 CAGGAAGTTCCCGCCGTTTGCGG No data
1058379312_1058379324 28 Left 1058379312 9:104361357-104361379 CCCTGGAGAATCTCGCACTGGCC No data
Right 1058379324 9:104361408-104361430 CAGGAAGTTCCCGCCGTTTGCGG No data
1058379320_1058379324 7 Left 1058379320 9:104361378-104361400 CCTGGGAACTGGGAGAACAGGGT No data
Right 1058379324 9:104361408-104361430 CAGGAAGTTCCCGCCGTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058379324 Original CRISPR CAGGAAGTTCCCGCCGTTTG CGG Intergenic
No off target data available for this crispr