ID: 1058379325

View in Genome Browser
Species Human (GRCh38)
Location 9:104361411-104361433
Sequence GAAGTTCCCGCCGTTTGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058379313_1058379325 30 Left 1058379313 9:104361358-104361380 CCTGGAGAATCTCGCACTGGCCT No data
Right 1058379325 9:104361411-104361433 GAAGTTCCCGCCGTTTGCGGAGG No data
1058379320_1058379325 10 Left 1058379320 9:104361378-104361400 CCTGGGAACTGGGAGAACAGGGT No data
Right 1058379325 9:104361411-104361433 GAAGTTCCCGCCGTTTGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058379325 Original CRISPR GAAGTTCCCGCCGTTTGCGG AGG Intergenic
No off target data available for this crispr