ID: 1058379332

View in Genome Browser
Species Human (GRCh38)
Location 9:104361423-104361445
Sequence GTTTGCGGAGGGGAGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058379320_1058379332 22 Left 1058379320 9:104361378-104361400 CCTGGGAACTGGGAGAACAGGGT No data
Right 1058379332 9:104361423-104361445 GTTTGCGGAGGGGAGGAGCCTGG No data
1058379323_1058379332 -5 Left 1058379323 9:104361405-104361427 CCACAGGAAGTTCCCGCCGTTTG No data
Right 1058379332 9:104361423-104361445 GTTTGCGGAGGGGAGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058379332 Original CRISPR GTTTGCGGAGGGGAGGAGCC TGG Intergenic
No off target data available for this crispr