ID: 1058382327

View in Genome Browser
Species Human (GRCh38)
Location 9:104390716-104390738
Sequence GTGGAGGCTTAAATTTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058382327_1058382333 19 Left 1058382327 9:104390716-104390738 CCTTCATAAATTTAAGCCTCCAC No data
Right 1058382333 9:104390758-104390780 TTTCTTCGGTTATTTTGCTTTGG No data
1058382327_1058382332 5 Left 1058382327 9:104390716-104390738 CCTTCATAAATTTAAGCCTCCAC No data
Right 1058382332 9:104390744-104390766 CCATAAAAAGTGATTTTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058382327 Original CRISPR GTGGAGGCTTAAATTTATGA AGG (reversed) Intergenic
No off target data available for this crispr