ID: 1058389167

View in Genome Browser
Species Human (GRCh38)
Location 9:104475246-104475268
Sequence TTCCTATACCACTTCAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058389165_1058389167 -5 Left 1058389165 9:104475228-104475250 CCACTGATTCAGCATCAGTTCCT No data
Right 1058389167 9:104475246-104475268 TTCCTATACCACTTCAGGAATGG No data
1058389164_1058389167 15 Left 1058389164 9:104475208-104475230 CCAATTCTATTGTCTCTGAGCCA No data
Right 1058389167 9:104475246-104475268 TTCCTATACCACTTCAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058389167 Original CRISPR TTCCTATACCACTTCAGGAA TGG Intergenic
No off target data available for this crispr