ID: 1058392642

View in Genome Browser
Species Human (GRCh38)
Location 9:104513302-104513324
Sequence TTGGACTAGTAAGTAAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058392636_1058392642 3 Left 1058392636 9:104513276-104513298 CCCAGGTTCTTCAAAAGGTTCTG No data
Right 1058392642 9:104513302-104513324 TTGGACTAGTAAGTAAACTGTGG No data
1058392637_1058392642 2 Left 1058392637 9:104513277-104513299 CCAGGTTCTTCAAAAGGTTCTGG No data
Right 1058392642 9:104513302-104513324 TTGGACTAGTAAGTAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058392642 Original CRISPR TTGGACTAGTAAGTAAACTG TGG Intergenic
No off target data available for this crispr