ID: 1058394267 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:104532350-104532372 |
| Sequence | AAATATAGGCCTCATATGAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1058394264_1058394267 | 12 | Left | 1058394264 | 9:104532315-104532337 | CCAGTTCTTAGACAATAGCTAAT | No data | ||
| Right | 1058394267 | 9:104532350-104532372 | AAATATAGGCCTCATATGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1058394267 | Original CRISPR | AAATATAGGCCTCATATGAC TGG | Intergenic | ||