ID: 1058394267

View in Genome Browser
Species Human (GRCh38)
Location 9:104532350-104532372
Sequence AAATATAGGCCTCATATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058394264_1058394267 12 Left 1058394264 9:104532315-104532337 CCAGTTCTTAGACAATAGCTAAT No data
Right 1058394267 9:104532350-104532372 AAATATAGGCCTCATATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058394267 Original CRISPR AAATATAGGCCTCATATGAC TGG Intergenic