ID: 1058401510

View in Genome Browser
Species Human (GRCh38)
Location 9:104625103-104625125
Sequence CTCGCCCAGGGAACCCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058401503_1058401510 15 Left 1058401503 9:104625065-104625087 CCCATCACAGGCTGGAGGCCTAG No data
Right 1058401510 9:104625103-104625125 CTCGCCCAGGGAACCCCTGCTGG No data
1058401507_1058401510 -3 Left 1058401507 9:104625083-104625105 CCTAGGAGAAAGTGGTTTCGCTC No data
Right 1058401510 9:104625103-104625125 CTCGCCCAGGGAACCCCTGCTGG No data
1058401504_1058401510 14 Left 1058401504 9:104625066-104625088 CCATCACAGGCTGGAGGCCTAGG No data
Right 1058401510 9:104625103-104625125 CTCGCCCAGGGAACCCCTGCTGG No data
1058401502_1058401510 18 Left 1058401502 9:104625062-104625084 CCTCCCATCACAGGCTGGAGGCC No data
Right 1058401510 9:104625103-104625125 CTCGCCCAGGGAACCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058401510 Original CRISPR CTCGCCCAGGGAACCCCTGC TGG Intergenic