ID: 1058412127

View in Genome Browser
Species Human (GRCh38)
Location 9:104745736-104745758
Sequence ATGCAGTTAATGATGAGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058412124_1058412127 0 Left 1058412124 9:104745713-104745735 CCCTGTATCTTTCTGCTGGATGG No data
Right 1058412127 9:104745736-104745758 ATGCAGTTAATGATGAGACTAGG No data
1058412121_1058412127 26 Left 1058412121 9:104745687-104745709 CCTCTTGGAAATTCCTCTTGGAA No data
Right 1058412127 9:104745736-104745758 ATGCAGTTAATGATGAGACTAGG No data
1058412122_1058412127 13 Left 1058412122 9:104745700-104745722 CCTCTTGGAAGTTCCCTGTATCT No data
Right 1058412127 9:104745736-104745758 ATGCAGTTAATGATGAGACTAGG No data
1058412126_1058412127 -1 Left 1058412126 9:104745714-104745736 CCTGTATCTTTCTGCTGGATGGA No data
Right 1058412127 9:104745736-104745758 ATGCAGTTAATGATGAGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058412127 Original CRISPR ATGCAGTTAATGATGAGACT AGG Intergenic
No off target data available for this crispr